Cataract Panel

Summary
Is a 113 gene panel that includes assessment of non-coding variants.

In addition, it also includes the maternally inherited mitochondrial genome.
Is ideal for patients with a clinical suspicion / diagnosis of congenital cataracts or a syndrome with cataracts as a feature.

Analysis methods
  • PLUS
Availability
4 weeks
Number of genes
113
Test code
OP0201
Panel tier
Tier 4
* The CPT codes provided are based on AMA guidelines and are for informational purposes only. CPT coding is the sole responsibility of the billing party. Please direct any questions regarding coding to the payer being billed.

Summary

The Blueprint Genetics Cataract Panel (test code OP0201):

Read about our accreditations, certifications and CE-marked IVD medical devices here.

ICD Codes

Refer to the most current version of ICD-10-CM manual for a complete list of ICD-10 codes.

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Please see Sample Requirements for accepted saliva kits)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.

Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.

Read more about our sample requirements here.

Cataract is defined as opacification of the normally transparent crystalline lens. Cataract can be classified as congenital, infantile, juvenile, presenile, and senile. Congenital cataract (CC) is present at birth or during early childhood and is one of the most common ocular diseases causing visual impairment or blindness in children worldwide. Nuclear cataract is the most common type of hereditary CC and is characterized by the opacification limited to the embryonic and/or fetal nuclei of the lens (PMID: 24384146). It can be inherited in an autosomal dominant, autosomal recessive, or X-linked manner, of which the autosomal dominant mode is the most common. Nuclear CC is genetically highly heterogeneous. Mutations in lens crystallins (CRYAACRYABCRYBB1CRYBB2CRYBB3CRYGCCRYGD) explain approximately half of the cases, followed by connexins (GJA3GJA8). Congenital nuclear cataract can be isolated (70%) or associated with other ocular disorders, such as microphthalmia or aniridia. It may also be part of multisystem genetic disorders such as Nance-Horan syndrome (NHS), Lowe syndrome (OCRL) or neurofibromatosis type 2 (NF2). The prevalence of cataract in children has been estimated between 1-15:10,000.

Genes in the Cataract Panel and their clinical significance

To view complete table content, scroll horizontally.

Gene Associated phenotypes Inheritance ClinVar HGMD
ABCB6 Blood group, Langereis system, Pseudohyperkalemia, Dyschromatosis universalis hereditaria, Microphthalmia, isolated, with coloboma 7 AD/BG 9 20
ADAMTS18 Knobloch syndrome 2, Microcornea, myopic chorioretinal atrophy, and telecanthus, Retinal dystrophy, early onset, autosomal recessive AR 4 14
ADAMTSL4 Ectopia lentis, isolated AR 11 27
AGK* Sengers syndrome, Cataract 38 AR 18 27
ALDH18A1 Spastic paraplegia, Cutis laxa AD/AR 22 30
BCOR Microphthalmia, syndromic, Oculofaciocardiodental syndrome XL 40 53
BFSP1 Cataract 33 AR 4 7
BFSP2 Cataract AD 2 7
CHMP4B Cataract 31, multiple types AD 2 2
COL11A1 Marshall syndrome, Fibrochondrogenesis, Stickler syndrome type 2 AD/AR 34 94
COL18A1 Knobloch syndrome AR 27 31
COL2A1 Avascular necrosis of femoral head, Rhegmatogenous retinal detachment, Epiphyseal dysplasia, with myopia and deafness, Czech dysplasia, Achondrogenesis type 2, Platyspondylic dysplasia Torrance type, Hypochondrogenesis, Spondyloepiphyseal dysplasia congenital (SEDC), Spondyloepimetaphyseal dysplasia (SEMD) Strudwick type, Kniest dysplasia, Spondyloperipheral dysplasia, Mild SED with premature onset arthrosis, SED with metatarsal shortening, Stickler syndrome type 1 AD 180 561
COL4A1 Schizencephaly, Anterior segment dysgenesis with cerebral involvement, Retinal artery tortuosity, Porencephaly, Angiopathy, hereditary, with nephropathy, aneurysms, and muscle cramps, Brain small vessel disease AD 58 107
CRYAA Cataract AD/AR 12 24
CRYAB Cataract, myofibrillar myopathy and cardiomyopathy, Congenital cataract and cardiomyopathy, Dilated cardiomyopathy (DCM), Myopathy, myofibrillar, Cataract 16, multiple types, Myopathy, myofibrillar, fatal infantile hypertonic, alpha-B crystallin-related AD 14 28
CRYBA1 Cataract 10, multiple types AD 9 13
CRYBA4 Cataract 23 AD 4 10
CRYBB1 Cataract AD/AR 7 18
CRYBB2* Cataract AD 10 27
CRYBB3 Cataract AR 3 7
CRYGC Cataract AD 10 28
CRYGD Cataract AD 10 26
CRYGS Cataract, progressive polymorphic cortical AD 3 8
CTDP1 Congenital cataracts, facial dysmorphism, and neuropathy AR 1 1
CYP27A1 Cerebrotendinous xanthomatosis AR 69 110
DNMBP Cataract AR
EPHA2 Cataract 6, multiple types AD/AR 7 20
ERCC2 Xeroderma pigmentosum, Trichothiodystrophy, photosensitive, Cerebrooculofacioskeletal syndrome 2 AR 26 98
ERCC5 Xeroderma pigmentosum, Xeroderma pigmentosum/Cockayne syndrome AR 21 54
ERCC6* Xeroderma Pigmentosum-Cockayne Syndrome, De Sanctis-Cacchione syndrome AD/AR 87 135
ERCC8 UV-sensitive syndrome, Cockayne syndrome AR 34 64
EYA1 Otofaciocervical syndrome, Branchiootic syndrome, Branchiootorenal syndrome AD 56 218
FAM126A Leukodystrophy, hypomyelinating AR 8 12
FOXE3 Aphakia, congenital primary, Anterior segment mesenchymal dysgenesis, Cataract 34, Aortic aneurysm, familial thoracic AR/AD 9 29
FTL Hyperferritinemia-cataract syndrome, L-ferritin deficiency, Neurodegeneration with brain iron accumulation AD/AR 21 63
FYCO1 Cataract AR 10 20
FZD4 Retinopathy of prematurity, Exudative vitreoretinopathy AD/Digenic 14 90
GALE Galactose epimerase deficiency AR 12 26
GALK1 Galactokinase deficiency AR 15 44
GALT Galactosemia AR 238 330
GCNT2 Blood group, Ii, Adult i pheno without cataract, Cataract 13 with adult i pheno BG/AR 11 11
GJA1* Oculodentodigital dysplasia mild type, Oculodentodigital dysplasia severe type, Syndactyly type 3 AD/AR 31 107
GJA3 Cataract AD 14 43
GJA8 Cataract AD/AR 20 61
HSF4 Cataract AD/AR 8 18
LEMD2 Cataract 46, juvenile onset, Arrhythmogenic right ventricular cardiomyopathy (ARVC), Dilated cardiomyopathy (DCM) AR 1 1
LIM2 Cataract AR 2 4
MAF Ayme-Gripp syndrome, Cataract 21, multiple types AD 21 22
MIP Cataract 15, multiple types AD 11 27
MT-ATP6 Neuropathy, ataxia, and retinitis pigmentosa, Leber hereditary optic neuropathy, Ataxia and polyneuropathy, adult-onset, Cardiomyopathy, infantile hypertrophic, Leigh syndrome, Striatonigral degeneration, infantile, mitochondrial Mitochondrial 19
MT-ATP8 Cardiomyopathy, apical hypertrophic, and neuropathy, Cardiomyopathy, infantile hypertrophic Mitochondrial 4
MT-CO1 Myoglobinuria, recurrent, Leber hereditary optic neuropathy, Sideroblastic anemia, Cytochrome C oxidase deficiency Mitochondrial 17
MT-CO2 Cytochrome c oxidase deficiency Mitochondrial 8
MT-CO3 Cytochrome c oxidase deficiency, Leber hereditary optic neuropathy Mitochondrial 9
MT-CYB Mitochondrial 69
MT-ND1 Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes, Leber hereditary optic neuropathy, Leber optic atrophy and dystonia Mitochondrial 21
MT-ND2 Leber hereditary optic neuropathy, Mitochondrial complex I deficiency Mitochondrial 6
MT-ND3 Leber optic atrophy and dystonia, Mitochondrial complex I deficiency Mitochondrial 7
MT-ND4 Leber hereditary optic neuropathy, Leber optic atrophy and dystonia, Mitochondrial complex I deficiency Mitochondrial 11
MT-ND4L Leber hereditary optic neuropathy Mitochondrial 2
MT-ND5 Myoclonic epilepsy with ragged red fibers, Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes, Leber hereditary optic neuropathy, Mitochondrial complex I deficiency Mitochondrial 19
MT-ND6 Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes, Oncocytoma, Leber hereditary optic neuropathy, Leber optic atrophy and dystonia, Mitochondrial complex I deficiency Mitochondrial 16
MT-RNR1 Deafness, mitochondrial Mitochondrial 3
MT-RNR2 Chloramphenicol toxicity/resistance Mitochondrial 2
MT-TA Mitochondrial 4
MT-TC Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes Mitochondrial 3
MT-TD Mitochondrial 1
MT-TE Diabetes-deafness syndrome, Mitochondrial myopathy, infantile, transient, Mitochondrial myopathy with diabetes Mitochondrial 5
MT-TF Myoclonic epilepsy with ragged red fibers, Nephropathy, tubulointerstitial, Encephalopathy, mitochondrial, Epilepsy, mitochondrial, Myopathy, mitochondrial, Mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes Mitochondrial 7
MT-TG Mitochondrial 3
MT-TH Mitochondrial 4
MT-TI Mitochondrial 7
MT-TK Mitochondrial 5
MT-TL1 Cytochrome c oxidase deficiency, Myoclonic epilepsy with ragged red fibers, Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes, Diabetes-deafness syndrome, Cyclic vomiting syndrome, SIDS, susceptibility to Mitochondrial 14
MT-TL2 Mitochondrial multisystemic disorder, Progressive external ophthalmoplegia Mitochondrial 5
MT-TM Leigh syndrome, Mitochondrial multisystemic disorder Mitochondrial 1
MT-TN Progressive external ophthalmoplegia, Mitochondrial multisystemic disorder Mitochondrial 3
MT-TP Mitochondrial 2
MT-TQ Mitochondrial multisystemic disorder Mitochondrial 2
MT-TR Encephalopathy, mitochondrial Mitochondrial 2
MT-TS1 Myoclonic epilepsy with ragged red fibers, Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes Mitochondrial 10
MT-TS2 Mitochondrial multisystemic disorder Mitochondrial 2
MT-TT Mitochondrial 5
MT-TV Hypertrophic cardiomyopathy (HCM), Leigh syndrome, Mitochondrial multisystemic disorder Mitochondrial 3
MT-TW Leigh syndrome, Myopathy, mitochondrial Mitochondrial 8
MT-TY Mitochondrial multisystemic disorder Mitochondrial 4
MYH9 Sebastian syndrome, May-Hegglin anomaly, Epstein syndrome, Fechtner syndrome, Macrothrombocytopenia and progressive sensorineural deafness, Deafness, autosomal dominant 17 AD 25 117
NDP Exudative vitreoretinopathy, Norrie disease XL 31 167
NF2 Schwannomatosis, Neurofibromatosis AD 66 433
NHS Nance-Horan syndrome, Cataract XL 36 52
OCRL Lowe syndrome, Dent disease XL 47 264
OPA3 Optic atrophy, 3-methylglutaconic aciduria AD/AR 13 15
P3H2 Myopia, high, with cataract and vitreoretinal degeneration AR 7 7
PAX6 Aniridia, cerebellar ataxia, and mental retardation (Gillespie syndrome), Keratitis, Coloboma, ocular, Cataract with late-onset corneal dystrophy, Morning glory disc anomaly, Foveal hypoplasia, Aniridia, Optic nerve hypoplasia, Peters anomaly AD 144 550
PITX3 Cataract, Anterior segment mesenchymal dysgenesis AD 5 11
PXDN Anterior segment dysgenesis 7 AR 7 14
RAB18 Warburg micro syndrome 3 AR 5 5
RAB3GAP1 Warburg micro syndrome AR 29 66
RAB3GAP2 Warburg micro syndrome, Martsolf syndrome AR 11 15
RECQL4 Baller-Gerold syndrome, RAPADILINO syndrome, Rothmund-Thomson syndrome AR 82 114
SIL1 Marinesco-Sjogren syndrome AR 14 49
SIPA1L3 Cataract 45 AR 2 4
SLC16A12 Cataract 47 AD 3 18
SLC33A1* Congenital cataracts, hearing loss, and neurodegeneration, Spastic paraplegia 42, autosomal dominant AD/AR 6 7
TBC1D20 Warburg micro syndrome 4 AR 6 6
TDRD7 Cataract AR 5 5
TFAP2A Branchiooculofacial sydrome AD 23 42
TMEM70 Mitochondrial complex V (ATP synthase) deficiency AR 12 18
VIM Cataract 30, multiple types AD 2 3
VSX2 Microphthalmia, isolated 2, Microphthalmia, isolated, with coloboma 3 AR 9 13
WFS1 Wolfram syndrome, Deafness, Wolfram-like syndrome, autosomal dominant, Deafness, autosomal dominant 6/14/38, Cataract 41 AD/AR 69 362
WRN* Werner syndrome AR 64 107
XYLT2 Spondyloocular syndrome AR 2 10
#

The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.

*

Some, or all, of the gene is duplicated in the genome. Read more.

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.

Non-coding variants covered by Cataract Panel

To view complete table content, scroll horizontally.

Gene Genomic location HG19 HGVS RefSeq RS-number
COL11A1 Chr1:103386637 c.3744+437T>G NM_080629.2
COL11A1 Chr1:103488576 c.1027-24A>G NM_080629.2
COL11A1 Chr1:103491958 c.781-450T>G NM_080629.2 rs587782990
COL4A1 Chr13:110802675 c.*35C>A NM_001845.4
COL4A1 Chr13:110802678 c.*32G>A/T NM_001845.4
COL4A1 Chr13:110802679 c.*31G>T NM_001845.4
ERCC5 Chr13:103514354 c.881-26T>G NM_000123.3
ERCC6 Chr10:50681659 c.2599-26A>G NM_000124.3 rs4253196
ERCC8 Chr5:60223572 c.173+1119G>C NM_000082.3
ERCC8 Chr5:60223645 c.173+1046A>G NM_000082.3
EYA1 Chr8:72156939 c.1051-12T>G NM_000503.4
EYA1 Chr8:72211483 c.640-15G>A NM_000503.4
FTL Chr19:49468574 c.-189_-161delGGTCCCGCGGGTCTGTCTCTTGCTTCAAC NM_000146.3
FTL Chr19:49468575 c.-190C>T NM_000146.3
FTL Chr19:49468579 c.-186C>G NM_000146.3
FTL Chr19:49468581 c.-184C>T NM_000146.3
FTL Chr19:49468583 c.-182C>T NM_000146.3
FTL Chr19:49468583 c.-182_-178delCGGGTinsTGGGG NM_000146.3
FTL Chr19:49468586 c.-175_-170delGTCTCT NM_000146.3 rs398124639
FTL Chr19:49468587 c.-178T>G NM_000146.3
FTL Chr19:49468589 c.-176T>C NM_000146.3
FTL Chr19:49468593 c.-168_-165delGCTT NM_000146.3
FTL Chr19:49468594 c.-171C>G NM_000146.3
FTL Chr19:49468597 c.-168G>C NM_000146.3
FTL Chr19:49468597 c.-168G>A/C/T NM_000146.3 rs398124635
FTL Chr19:49468597 c.-168G>A NM_000146.3
FTL Chr19:49468597 c.-168G>T NM_000146.3
FTL Chr19:49468598 c.-167C>A NM_000146.3
FTL Chr19:49468598 c.-167C>T NM_000146.3
FTL Chr19:49468598 c.-167C>A/T NM_000146.3
FTL Chr19:49468599 c.-166T>C NM_000146.3
FTL Chr19:49468601 c.-164C>G NM_000146.3
FTL Chr19:49468601 c.-158_-143delTGTTTGGACGGAACAG NM_000146.3
FTL Chr19:49468601 c.-164C>A/T NM_000146.3 rs398124637
FTL Chr19:49468602 c.-163A>C/G/T NM_000146.3
FTL Chr19:49468602 c.-161_-160delCA NM_000146.3
FTL Chr19:49468602 c.-163A>T NM_000146.3
FTL Chr19:49468602 c.-163A>G NM_000146.3
FTL Chr19:49468602 c.-163A>C NM_000146.3
FTL Chr19:49468603 c.-161delC NM_000146.3
FTL Chr19:49468604 c.-161C>A/G NM_000146.3
FTL Chr19:49468604 c.-161C>T NM_000146.3 rs398124636
FTL Chr19:49468605 c.-160A>G NM_000146.3 rs398124633
FTL Chr19:49468606 c.-159G>C NM_000146.3 rs398124634
FTL Chr19:49468608 c.-157G>A NM_000146.3
FTL Chr19:49468611 c.-154T>G NM_000146.3
FTL Chr19:49468612 c.-153G>A NM_000146.3
FTL Chr19:49468612 c.-153_-152delGGinsCT NM_000146.3
FTL Chr19:49468614 c.-151A>C NM_000146.3
FTL Chr19:49468614 c.-151A>G NM_000146.3
FTL Chr19:49468615 c.-150C>A NM_000146.3
FTL Chr19:49468616 c.-149G>C NM_000146.3 rs398124638
FTL Chr19:49468617 c.-148G>C NM_000146.3
FTL Chr19:49468621 c.-144A>T NM_000146.3
FTL Chr19:49468655 c.-110C>T NM_000146.3
FTL Chr19:49468720 c.-44delT NM_000146.3 rs772029022
GALK1 Chr17:73761239 c.-22T>C NM_000154.1 rs545362817
GALT Chr9:34646606 c.-96T>G NM_000155.3
GALT Chr9:34647075 c.83-11T>G NM_000155.3
GALT Chr9:34648082 c.508-29delT NM_000155.3 rs111033711
GALT Chr9:34648519 c.687+66T>A NM_000155.3
GALT Chr9:34648904 c.820+13A>G NM_000155.3 rs111033768
GALT Chr9:34649617 c.1059+56C>T NM_000155.3 rs111033821
NDP ChrX:43818099 c.-207-1G>A NM_000266.3
NDP ChrX:43832545 c.-208+5G>A NM_000266.3
NDP ChrX:43832548 c.-208+2T>G NM_000266.3
NDP ChrX:43832549 c.-208+1G>A NM_000266.3
NDP ChrX:43832685 c.-343A>G NM_000266.3 rs895911086
NDP ChrX:43832722 c.-391_-380delCTCTCTCTCCCTinsGTCTCTC NM_000266.3
NDP ChrX:43832724 c.-396_-383delTCCCTCTCTCTCTC NM_000266.3 rs770996360
NF2 Chr22:30050946 c.516+232G>A NM_000268.3
OCRL ChrX:128674707 c.40-14A>G NM_000276.3
OCRL ChrX:128687279 c.239-4023A>G NM_000276.3
OCRL ChrX:128696350 c.940-11G>A NM_000276.3
PAX6 Chr11:31685945 c.*125537G>T NM_000280.4 rs606231388
PAX6 Chr11:31812434 c.1033-42_1033-26delATGTGTTCCTCAGTAACinsG NM_000280.4
PAX6 Chr11:31816377 c.524-41T>G NM_000280.4
PAX6 Chr11:31823338 c.142-14C>G NM_000280.4 rs1131692291
PAX6 Chr11:31828391 c.-52+5delG NM_000280.4
PAX6 Chr11:31828391 c.-52+3_-52+6delAAGTinsTG NM_000280.4
PAX6 Chr11:31828392 c.-52+3_-52+4delAA NM_000280.4
PAX6 Chr11:31828395 c.-52+1delG NM_000280.4
PAX6 Chr11:31828396 c.-52+1G>A NM_000280.4
PAX6 Chr11:31828456 c.-115_-112delACTA NM_000280.4 rs1011844558
PAX6 Chr11:31828461 c.-118_-117delTT NM_000280.4
PAX6 Chr11:31828469 c.-125dupG NM_000280.4
PAX6 Chr11:31828474 c.-128-1G>T NM_000280.4
PAX6 Chr11:31828474 c.-128-2delA NM_000280.4 rs1131692282
PAX6 Chr11:31832372 c.-138_-129+3delCCTCATAAAGGTG NM_000280.4
PAX6 Chr11:31832374 c.-129+2T>A NM_000280.4
PAX6 Chr11:31832375 c.-129+1G>A NM_000280.4
SIL1 Chr5:138283180 c.1030-18G>A NM_022464.4 rs769052639
WFS1 Chr4:6271704 c.-43G>T NM_006005.3
WRN Chr8:30966107 c.2089-3024A>G NM_000553.4 rs281865157
WRN Chr8:30999982 c.3234-160A>G NM_000553.4

Test Strengths

The strengths of this test include:

  • CAP accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene's target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:

  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:

  • Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments
  • Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section.

The genes on the panels have been carefully selected based on scientific literature, mutation databases and our experience.

The panels are sectioned from our high-quality, clinical grade NGS assay. The panel analysis is a combination of both sequence variants (SNVs and indels) as well as deletions and duplications (copy number variants (CNV)).

Please refer to the table below for performance metrics of the analytical validation of the assay. The validation includes the evaluation of reference samples to determine the capability of the assay to detect various types of variants. The sensitivity values quoted in the analytic validation may not precisely reflect the performance in a production setting and is not a guarantee of the assay’s clinical performance. The provided performance metrics are based on a validation conducted at our laboratory in Finland. The assay has been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva, and dried blood spots (filter cards).

Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Analytical sensitivity to detect single-nucleotide variants and indels were calculated using both versions v3.3.2 and v4.2.1 of high-confidence region benchmark data provided by Genome in a Bottle (GIAB) consortium. Version 4.2.1 is extended to include challenging medically relevant regions and other difficult to map regions. Version 4.2.1 covers 94.1% of reference (GRCh37) and v3.3.2 covers 87.8% of reference. For more information, see GIAB publication https://doi.org/10.1016/j.xgen.2022.100128.

Sensitivity % (TP/(TP+FN) Specificity %
GIAB Version 3.3.2 GIAB Version 4.2.1 GIAB Version 3.3.2 GIAB Version 4.2.1
Single nucleotide variants 99.57 % 97.58 % 100 % 100 %
Insertions, deletions
1-10 bps 95.38 % 95.13 % 100.00 % 100.00 %
11-20 bps 99.09 % 98.15 % 100.00 % 100.00 %
21-50 bps 98.78 % 98.85 % 100.00 % 100.00 %
2-50 bps 97.62 % 97.41 % 100.00 % 100.00 %
Copy number variants (exon level dels/dups, clinical sample performance) Sensitivity Specificity
1 exon level deletion (heterozygous) 100% (14/14) NA
1 exon deletion (homozygous or hemizygous) 100% (5/5) NA
2-4 exon deletion (heterozygous or homozygous) 100% (17/17) NA
5-33 exon deletion (heterozygous) 100% (12/12) NA
1-5 exon duplication (heterozygous or homozygous) 77% (10/13) NA
9-31 exon duplication (heterozygous) 100% (7/7) NA
Simulated CNV detection in reference samples (n=10) Sensitivity
5 exon level deletion/duplication 98 %
Microdeletion/-duplication syndromes (large CNVs, n=22))
Size range (0.1-47 Mb) 100% (22/22)
         
The performance presented above was reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics
Average of median sequencing depths in reference samples 136x
Nucleotides with >20x sequencing coverage (%) 99.77%


Performance of Blueprint Genetics Mitochondrial Sequencing Assay.

ANALYTIC VALIDATION (reference samples; n=4) Sensitivity %      
Single nucleotide variants
Heteroplasmic (45-100%) 100.0% (50/50)
Heteroplasmic (35-45%) 100.0% (87/87)
Heteroplasmic (25-35%) 100.0% (73/73)
Heteroplasmic (15-25%) 100.0% (74/74)
Heteroplasmic (5-15%) 100.0% (79/79)
Heteroplasmic (<5%) 53.3 % (8/15)
CLINICAL VALIDATION (n=20 samples)
Single nucleotide variants (n=18 SNVs) 100.0% (3/3)
Heteroplasmic (10-15%) 100.0% (5/5)
Heteroplasmic (5-10%) 100.0% (5/5)
Heteroplasmic (<5%) 20% (1/5)
Insertions and deletions by sequence analysis (n=3)
Heteroplasmic (45-100%) 1-10bp 100.0% (3/3)
Validation of the mitochondrial genome analysis workflow (based on simulated data of pathogenic mitomap mutations)
Insertions and deletions 1-24 bps by sequence analysis; n=17
Homoplasmic (100%) 1-24bp 100.0% (17/17)
Heteroplasmic (50%) 100.0% (17/17)
Heteroplasmic (25%) 100.0% (17/17)
Heteroplasmic (20%) 100.0% (17/17)
Heteroplasmic (15%) 100.0% (17/17)
Heteroplasmic (10%) 94.1% (16/17)
Heteroplasmic (5%) 94.1% (16/17)
Copy number variants (separate artifical mutations; n=1500)
Homoplasmic (100%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (50%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (30%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (20%) 500 bp, 1kb, 5 kb 99.7%
Heteroplasmic (10%) 500 bp, 1kb, 5 kb 99.0%
Following mtDNA coverage metrics were obtained in clinical samples in the assay validation (n=238)
Mean of medians
Mean sequencing depth MQ0 6334x
Nucleotides with >1000x MQ0 sequencing coverage (%) 100%
rho zero cell line (=no mtDNA), mean sequencing depth in mitochondrial assay validation 12X

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. If the test includes the mitochondrial genome the target region gene list contains the mitochondrial genes. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as  SIFT, PolyPhen,MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with suboptimal coverage (<20X for nuclear genes and <1000X for mtDNA) if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

We provide customers with comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our Ph.D. molecular geneticists, medical professionals, and other highly experienced experts prepare clinical reports by evaluating the identified variants in the context of the phenotypic information provided in the requisition form.

Our goal is to provide clinically meaningful reports that are understandable for all medical professionals regardless of whether they have formal training in genetics. Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015. Sequence and copy number variants classified as pathogenic, likely pathogenic, and variants of uncertain significance (VUS) are confirmed using bidirectional Sanger sequencing or by orthogonal methods such as qPCR/ddPCR when they do not meet our stringent NGS quality metrics for a true positive call.

Our clinical report includes tables for sequence and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, phenotypes, and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene, and phenotype(s), including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts, and detailed information about related phenotypes. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired.

The panel report is divided into primary findings and additional findings sections. Variants reported as primary findings are known disease-causing variants or rare variants that could potentially explain the patient’s phenotype as described to the laboratory at the time of interpretation. The conclusion summarizes all the existing information and provides our rationale for the classification of the variant.

Variants reported as additional findings are variants that are not likely or sufficient to cause the tested patient’s phenotype, based on the current knowledge. Additional findings in panel reports include variants that are, for example, carrierships of single heterozygous variants in genes associated with autosomal recessive disorders, variants of uncertain significance in genes associated with autosomal dominant disorders (if pathogenic or likely pathogenic variants considered sufficient to explain the patient’s phenotype are reported as primary findings), or risk alleles identified in genes included in the panel.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well positioned to reclassify previously reported variants as new information becomes available. If a variant previously reported as a primary or secondary finding by Blueprint Genetics is reclassified so that it becomes diagnostic (VUS to P/LP) or earlier molecular diagnosis is removed (P/LP to VUS, LB, B), our laboratory will issue a follow-up statement to the original ordering healthcare provider at no additional cost.