Comprehensive Proactive Screen

Summary

Is a 181 gene test for healthy adults who want information about their genetic predisposition for developing life-threatening diseases that can be monitored or even prevented before an individual develops symptoms, such as cardiovascular disease or cancer.

Analysis methods
  • PLUS
Availability
4 weeks
Number of genes
181
Test code
PS0005
* The CPT codes provided are based on AMA guidelines and are for informational purposes only. CPT coding is the sole responsibility of the billing party. Please direct any questions regarding coding to the payer being billed.

Summary

The Blueprint Genetics Comprehensive Proactive Screen (test code PS0005):

Read about our accreditations, certifications and CE-marked IVD medical devices here.

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Please see Sample Requirements for accepted saliva kits)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.

Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.

Read more about our sample requirements here.

The Comprehensive Proactive Screen test is for healthy adult individuals interested in learning about their genetic risk of developing certain conditions that can be monitored or even prevented before symptoms appear. After a positive result, healthcare provider can help their patient to make informed decisions about lifestyle choices or taking preventive actions.

Proactive Screen tests are for healthy adults who understand the pros and cons of proactive testing, thus these tests do not include genes that cause childhood conditions or conditions that lead to a recognizable phenotype.

These tests are for personal risk assessment of healthy individuals. Individuals with a family history of a hereditary disorder should have testing with the appropriate diagnostic panel instead of a Proactive Screen test.

The Comprehensive Proactive Screen test includes screening for
-A number of genes related mostly to increased risk of cancer, cardiovascular, pulmonary and hematological disorders with established management and intervention recommendations to prevent or reduce morbidity and mortality
-All genes in the ACMG 3.1 SF list (PMID: 35802134)
-Aminoglycoside hearing loss (MT-RNR1)
-Malignant hyperthermia

Only variants classified as pathogenic or likely pathogenic based on an ACMG/AMP classification scheme will be reported

Genes in the Comprehensive Proactive Screen and their clinical significance

To view complete table content, scroll horizontally.

Gene Associated phenotypes Inheritance ClinVar HGMD
ACTA2 Aortic aneurysm, familial thoracic, Moyamoya disease, Multisystemic smooth muscle dysfunction syndrome AD 20 76
ACTC1 Left ventricular noncompaction, Hypertrophic cardiomyopathy (HCM), Cardiomyopathy, restrictive, Atrial septal defect, Dilated cardiomyopathy (DCM) AD 23 63
ACTN2 Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy (DCM) AD 11 44
ACVRL1 Hereditary hemorrhagic telangiectasia AD 140 430
AIP Pituitary adenoma, familial isolated AD 53 110
ANKRD26 Thrombocytopenia AD 6 21
APC Gardner syndrome, Desmoid disease, hereditary, Familial adenomatous polyposis AD 773 1926
APOB Hypobetalipoproteinemia, Hypercholesterolemia AD/AR 69 306
ATM Breast cancer, Ataxia-Telangiectasia AD/AR 1047 1109
ATP7B Wilson disease AR 219 897
AXIN2 Oligodontia-colorectal cancer syndrome, Oligondontia, isolated AD 19 18
BAG3 Dilated cardiomyopathy (DCM), Myopathy, myofibrillar AD 39 62
BAP1 Tumor predisposition syndrome AD 74 113
BARD1 Breast cancer AD 159 114
BMPR1A* Polyposis, juvenile intestinal AD 110 140
BMPR2 Pulmonary hypertension, primary, Pulmonary venoocclusive disease AD 391 572
BRCA1* Pancreatic cancer, Breast-ovarian cancer, familial AD 2997 2631
BRCA2 Fanconi anemia, Medulloblastoma, Glioma susceptibility, Pancreatic cancer, Wilms tumor, Breast-ovarian cancer, familial AD/AR 3369 2659
BRIP1 Fanconi anemia, Breast cancer AD/AR 238 189
BTD Biotinidase deficiency AR 170 247
CACNA1C* Brugada syndrome, Timothy syndrome AD 19 68
CACNA1S Hypokalemic periodic paralysis, Malignant hyperthermia, Thyrotoxic periodic paralysis AD 14 47
CALM1* Ventricular tachycardia, catecholaminergic polymorphic, Recurrent cardiac arrest, infantile, Long QT syndrome AD 10 10
CALM2 Long QT syndrome AD 8 10
CALM3 Catecholaminergic polymorphic ventricular tachycardia AD/AR 4 4
CASQ2 Ventricular tachycardia, catecholaminergic, polymorphic AR 24 34
CASZ1 Dilated cardiomyopathy (DCM), Ventricular septal defect AD 3 2
CAV1 Partial lipodystrophy, congenital cataracts, and neurodegeneration syndrome, Lipodystrophy, congenital generalized, Pulmonary hypertension, primary 3 AD/AR 7 11
CDC73 Carcinoma, parathyroid, Hyperparathyroidism, Hyperparathyroidism-jaw tumor syndrome AD 50 101
CDH1 CDH1-related cancer, Blepharocheilodontic syndrome 1 AD 178 242
CDK4 Melanoma, cutaneous malignant AD 4 14
CDKN1B Multiple endocrine neoplasia AD 13 20
CDKN2A Melanoma, familial, Melanoma-pancreatic cancer syndrome AD 87 232
CEBPA Acute myeloid leukemia, familial AD 15 13
CHEK2#* Li-Fraumeni syndrome AD/AR 275 197
CHRM2 Dilated cardiomyopathy (DCM) AD/AR 1
COL3A1 Ehlers-Danlos syndrome AD 520 631
COL5A1 Ehlers-Danlos syndrome AD 101 154
COL5A2 Ehlers-Danlos syndrome AD 24 35
CSRP3 Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy (DCM) AD 4 30
CTNNA1 Macular dystrophy, patterned 2 AD 6 10
CYLD Spiegler-Brooke syndrome, Trichoepithelioma, multiple, Cylindromatosis AD 34 106
DDX41 Familial myeloproliferative/lymphoproliferative neoplasms, multiple types, susceptibility to AD 9 21
DES Dilated cardiomyopathy (DCM), Myopathy, myofibrillar, Scapuloperoneal syndrome, neurogenic, Kaeser type AD/AR 64 124
DICER1* DICER1 syndrome AD 197 137
DMD Becker muscular dystrophy, Duchenne muscular dystrophy, Dilated cardiomyopathy (DCM) XL 832 3915
DSC2 Arrhythmogenic right ventricular dysplasia with palmoplantar keratoderma and woolly hair, Arrhythmogenic right ventricular dysplasia AD/AR 32 87
DSG2 Arrhythmogenic right ventricular dysplasia, Dilated cardiomyopathy (DCM) AD 44 129
DSP Cardiomyopathy, dilated, with wooly hair, keratoderma, and tooth agenesis, Arrhythmogenic right ventricular dysplasia, familial, Cardiomyopathy, dilated, with wooly hair and keratoderma, Keratosis palmoplantaris striata II, Epidermolysis bullosa, lethal acantholytic AD/AR 177 296
EGFR Lung cancer, familial, susceptibilty to, Inflammatory skin and bowel disease, neonatal, Acute myeloid leukemia, familial AD/AR 55 18
EMD Emery-Dreifuss muscular dystrophy XL 48 113
ENG Juvenile polyposis syndrome, Hereditary hemorrhagic telangiectasia AD 158 491
EPCAM Diarrhea 5, with tufting enteropathy, congenital, Colorectal cancer, hereditary nonpolyposis AD/AR 38 80
ERCC6L2 Bone marrow failure syndrome 2 AR 4 9
ETV6 Thrombocytopenia 5 AD 10 38
EXT1 Multiple cartilagenious exostoses 1 AD 97 523
EXT2 Multiple cartilagenious exostoses 2 AD 45 250
F5 Factor V deficiency, Thrombophilia due to activated protein C resistance AD/AR 19 157
FBN1 MASS syndrome, Marfan syndrome, Acromicric dysplasia, Geleophysic dysplasia 3 AD 1465 2679
FH Hereditary leiomyomatosis and renal cell cancer AD/AR 178 207
FHL1* Myopathy with postural muscle atrophy, Emery-Dreifuss muscular dystrophy, Reducing bod myopathy XL 26 62
FLCN Birt-Hogg-Dube syndrome, Pneumothorax, primary spontaneous AD 154 210
FLNC* Myopathy AD 54 109
GAA Glycogen storage disease AR 193 573
GATA2 Myelodysplastic syndrome, Chronic neutropenia associated with monocytopenia, evolving to myelodysplasia and acute myeloid leukemia, Acute myeloid leukemia, Emberger syndrome, Immunodeficiency AD 30 142
GATA4* Tetralogy of Fallot, Atrioventricular septal defect, Testicular anomalies with or without congenital heart disease, Ventricular septal defect, Atrial septal defect AD 37 140
GDF2 Hereditary hemorrhagic telangiectasia, type 5, Pulmonary arterial hypertension (PAH) AD 3 17
GLA Fabry disease XL 226 937
GREM1 Hereditary mixed polyposis syndrome AD/AR 1 8
HCN4 Sick sinus syndrome, Brugada syndrome, Left ventricular non-compaction cardiomyopathy (LVNC) AD 8 34
HFE Hemochromatosis AR/Digenic 11 56
HNF1A Maturity onset diabetes of the young, Renal cell carcinoma, nonpapillary clear cell, Liver adenomatosis AD 78 528
HOXB13 Familial prostate cancer AD/AR 1 5
JUP Arrhythmogenic right ventricular dysplasia, Naxos disease AD/AR 8 46
KCNE1 Long QT syndrome, Jervell and Lange-Nielsen syndrome AD/AR/Digenic 11 46
KCNE2 Long QT syndrome, Atrial fibrillation, familial AD 5 24
KCNH2 Short QT syndrome, Long QT syndrome AD 371 933
KCNJ2 Short QT syndrome, Andersen syndrome, Long QT syndrome, Atrial fibrillation AD 41 93
KCNQ1 Short QT syndrome, Long QT syndrome, Atrial fibrillation, Jervell and Lange-Nielsen syndrome AD/AR 298 631
KIT Gastrointestinal stromal tumor, Piebaldism AD 79 116
LAMP2 Danon disease XL 62 101
LDLR Hypercholesterolemia AD/AR 1719 2180
LDLRAP1 Hypercholesterolemia AR 10 23
LMNA Heart-hand syndrome, Slovenian, Limb-girdle muscular dystrophy, Muscular dystrophy, congenital, LMNA-related, Lipodystrophy (Dunnigan), Emery-Dreiffus muscular dystrophy, Malouf syndrome, Dilated cardiomyopathy (DCM), Mandibuloacral dysplasia type A, Progeria Hutchinson-Gilford type AD/AR 250 564
LMOD2 Familial dilated cardiomyopathy AR
LZTR1 Schwannomatosis, Noonan syndrome AD/AR 34 71
MAX Pheochromocytoma AD 13 31
MEN1 Hyperparathyroidism, familial primary, Multiple endocrine neoplasia AD 263 730
MET Deafness, Renal cell carcinoma, papillary, Osteofibrous dysplasia, susceptibility to AD/AR 20 34
MLH1 Muir-Torre syndrome, Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 873 1191
MSH2 Muir-Torre syndrome, Endometrial cancer, Colorectal cancer, hereditary nonpolyposis,, Mismatch repair cancer syndrome AD/AR 933 1249
MSH6 Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 672 586
MT-RNR1 Deafness, mitochondrial Mitochondrial 3
MUTYH Familial adenomatous polyposis,, Colorectal adenomatous polyposis, with pilomatricomas AR 134 168
MYBPC3 Left ventricular noncompaction, Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy (DCM) AD 482 1048
MYH11 Aortic aneurysm, familial thoracic AD/AR 16 48
MYH7 Hypertrophic cardiomyopathy (HCM), Myopathy, myosin storage, Myopathy, distal, Dilated cardiomyopathy (DCM) AD 305 986
MYL2 Hypertrophic cardiomyopathy (HCM), Infantile type I muscle fibre disease and cardiomyopathy AD 21 67
MYL3 Hypertrophic cardiomyopathy (HCM) AD/AR 12 41
MYLK* Aortic aneurysm, familial thoracic 7 AD 16 28
NBN Breast cancer, Nijmegen breakage syndrome, demonstrating report layout issue with very long condition descriptions AD/AR 188 97
NEXN Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy (DCM) AD 6 43
NF1* Watson syndrome, Neurofibromatosis, Neurofibromatosis-Noonan syndrome AD 1157 2901
NF2 Schwannomatosis, Neurofibromatosis AD 66 433
NKX2-5 Conotruncal heart malformations, Hypothyroidism, congenital nongoitrous,, Atrial septal defect, Ventricular septal defect 3, Conotruncal heart malformations, variable, Tetralogy of Fallot AD 45 108
NTHL1 Familial adenomatous polyposis 3 AR 7 3
OTC Ornithine transcarbamylase deficiency XL 343 513
PALB2 Fanconi anemia, Pancreatic cancer, Breast cancer AD/AR 495 406
PCSK9 Hypercholesterolemia AD 29 89
PDGFRA# Gastrointestinal stromal tumor AD 22 19
PHOX2B Central hypoventilation syndrome, congenital, Neuroblastoma, susceptiblity to, Neuroblastoma with Hirschsprung disease AD 11 86
PKP2#* Arrhythmogenic right ventricular dysplasia AD 150 289
PLN Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy (DCM) AD/AR 8 30
PMS2#* Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 319 342
POLD1 Colorectal cancer, Mandibular hypoplasia, deafness, progeroid features, and lipodystrophy syndrome, Idiopathic bronchiectasis, Immunodeficiency AD/AR 3 31
POLE Colorectal cancer, Facial dysmorphism, immunodeficiency, livedo, and short stature syndrome (FILS syndrome) AD/AR 8 70
POT1 Glioma susceptibility 9, Melanoma, cutaneous malignant, susceptibility to 10 AD 2 34
PRKAG2 Hypertrophic cardiomyopathy (HCM), Wolff-Parkinson-White syndrome, Glycogen storage disease of heart, lethal congenital AD 19 57
PRKAR1A Myxoma, intracardiac, Acrodysostosis, Pigmented nodular adrenocortical disease, Carney complex AD 75 183
PRKG1 Aortic aneurysm, familial thoracic 8 AD 2 3
PROC Thrombophilia, hereditary AD/AR 36 387
PROS1* Thrombophilia, hereditary AD/AR 23 416
PTCH1 Basal cell nevus syndrome AD 193 522
PTEN* Bannayan-Riley-Ruvalcaba syndrome, Lhermitte-Duclos syndrome, Cowden syndrome AD 435 638
RAD50 Breast cancer, Nijmegen breakage syndrome-like disorder AD/AR 183 88
RAD51C Fanconi anemia, Breast-ovarian cancer, familial AD/AR 107 125
RAD51D Ovarian cancer, familial AD 77 78
RAF1 LEOPARD syndrome, Noonan syndrome, Dilated cardiomyopathy (DCM) AD 45 53
RB1 Retinoblastoma AD 266 1102
RBM20 Dilated cardiomyopathy (DCM) AD 19 47
RECQL* Breast cancer AD 9 27
RET Hirschsprung disease, Central hypoventilation syndrome, congenital, Pheochromocytoma, Medullary thyroid carcinoma, Multiple endocrine neoplasia AD/AR 122 407
RHBDF2 Tylosis with esophageal cancer AD 2 4
RPE65 Retinitis pigmentosa, Leber congenital amaurosis AD/AR 31 197
RUNX1 Platelet disorder, familial, with associated myeloid malignancy AD 47 101
RYR1 Central core disease, Malignant hyperthermia, Minicore myopathy with external ophthalmoplegia, Centronuclear myopathy, Minicore myopathy, Multicore myopathy AD/AR 241 666
RYR2 Ventricular tachycardia, catecholaminergic polymorphic, Arrhythmogenic right ventricular dysplasia AD 124 372
SCN5A Heart block, nonprogressive, Heart block, progressive, Long QT syndrome, Ventricular fibrillation, Atrial fibrillation, Sick sinus syndrome, Brugada syndrome, Dilated cardiomyopathy (DCM) AD/AR/Digenic 234 899
SCNN1B Liddle syndrome, Pseudohypoaldosteronism, Bronchiectasis with or without elevated sweat chloride AD/AR 19 47
SCNN1G Liddle syndrome, Pseudohypoaldosteronism, Bronchiectasis with or without elevated sweat chloride AD/AR 8 20
SDHA* Leigh syndrome/Mitochondrial respiratory chain complex II deficiency, Gastrointestinal stromal tumor, Paragangliomas, Dilated cardiomyopathy (DCM), Cardiomyopathy, dilated, 1GG AD/AR 54 87
SDHAF2 Paragangliomas AD 4 5
SDHB Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Gastrointestinal stromal tumor, Paragangliomas, Cowden-like syndrome AD 151 272
SDHC Paraganglioma and gastric stromal sarcoma, Gastrointestinal stromal tumor, Paragangliomas AD 29 60
SDHD# Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Paragangliomas, Carcinoid tumors, intestinal, Cowden syndrome, Mitochondrial complex II deficiency AD 68 170
SERPINA1 Alpha-1-antitrypsin deficiency AR 49 80
SERPINC1 Antithrombin III deficiency AD/AR 44 412
SGCD Muscular dystrophy, limb-girdle, Dilated cardiomyopathy (DCM) AR 21 27
SMAD3 Aneurysms-osteoarthritis syndrome, Loeys-Dietz syndrome AD 48 82
SMAD4 Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome, Polyposis, juvenile intestinal, Myhre dysplasia, Hereditary hemorrhagic telangiectasia AD 179 143
SMAD9 Pulmonary hypertension, primary 2 AD 4 17
SMARCA4 Rhabdoid tumor predisposition syndrome AD 76 57
SMARCB1 Schwannomatosis, Rhabdoid tumor predisposition syndrome, Coffin-Siris syndrome 3 AD 36 118
STK11 Peutz-Jeghers syndrome AD 173 460
SUFU Medulloblastoma, Basal cell nevus syndrome AD 22 44
TAB2 Congenital heart defects, multiple types, 2 AD 13 31
TBX20* Atrial septal defect 4 AD 4 28
TCAP Muscular dystrophy, limb-girdle, Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy (DCM) AD/AR 12 28
TECRL Ventricular tachycardia, catecholaminergic polymorphic, 3 AR 2 3
TERC Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita AD 42 73
TERT Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita AD/AR 48 156
TGFB2 Loeys-Dietz syndrome AD 36 38
TGFB3 Loeys-Dietz syndrome (Reinhoff syndrome), Arrhythmogenic right ventricular dysplasia AD 19 26
TGFBR1 Loeys-Dietz syndrome AD 40 69
TGFBR2 Loeys-Dietz syndrome AD 58 139
TINF2 Revesz syndrome, Dyskeratosis congenita AD 25 42
TMEM127 Pheochromocytoma AD 30 52
TMEM43 Arrhythmogenic right ventricular dysplasia, Emery-Dreifuss muscular dystrophy AD 4 24
TNNC1 Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy (DCM) AD 9 24
TNNI3 Hypertrophic cardiomyopathy (HCM), Cardiomyopathy, restrictive, Dilated cardiomyopathy (DCM) AD/AR 56 129
TNNT2 Left ventricular noncompaction, Hypertrophic cardiomyopathy (HCM), Cardiomyopathy, restrictive, Dilated cardiomyopathy (DCM) AD 61 148
TP53 Colorectal cancer, Li-Fraumeni syndrome, Ependymoma, intracranial, Choroid plexus papilloma, Breast cancer, familial, Adrenocortical carcinoma, Osteogenic sarcoma, Hepatoblastoma, Non-Hodgkin lymphoma AD 393 505
TPM1 Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy (DCM) AD 34 98
TRDN Ventricular tachycardia, catecholaminergic polymorphic AR 19 6
TSC1 Lymphangioleiomyomatosis, Tuberous sclerosis AD 177 372
TSC2 Lymphangioleiomyomatosis, Tuberous sclerosis AD 396 1195
TTN* Dilated cardiomyopathy (DCM), Tibial muscular dystrophy, Limb-girdle muscular dystrophy, Hereditary myopathy with early respiratory failure, Myopathy, early-onset, with fatal cardiomyopathy (Salih myopathy), Muscular dystrophy, limb-girdle, type 2J AD 818 327
TTR Dystransthyretinemic hyperthyroxinemia, Amyloidosis, hereditary, transthyretin-related AD 52 148
VCL Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy (DCM) AD 8 30
VHL Erythrocytosis, familial, Pheochromocytoma AD/AR 206 614
WT1 Denys-Drash syndrome, Frasier syndrome, Wilms tumor, Nephrotic syndrome, type 4 AD 42 183
#

The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.

*

Some, or all, of the gene is duplicated in the genome. Read more.

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.

Non-coding variants covered by Comprehensive Proactive Screen

To view complete table content, scroll horizontally.

Gene Genomic location HG19 HGVS RefSeq RS-number
ACTC1 Chr15:35080829 c.*1784T>C NM_005159.4
ACVRL1 Chr12:52314269 c.1378-274C>G NM_000020.2
ACVRL1 Chr12:52314327 c.1378-216C>G NM_000020.2
ACVRL1 Chr12:52314387 c.1378-156_1378-155invCT NM_000020.2
ACVRL1 Chr12:52314412 c.1378-131C>G NM_000020.2
ACVRL1 Chr12:52314465 c.1378-78T>G NM_000020.2
ACVRL1 Chr12:52314474 c.1378-69C>A NM_000020.2
AIP Chr11:67250360 NM_003977.2 rs267606588
AIP Chr11:67250410 c.-220G>A NM_003977.2 rs267606540
ANKRD26 Chr10:27389371 c.-116C>G NM_014915.2
ANKRD26 Chr10:27389373 c.-118C>A NM_014915.2
ANKRD26 Chr10:27389374 c.-119C>A NM_014915.2
ANKRD26 Chr10:27389374 c.-119C>A/G NM_014915.2
ANKRD26 Chr10:27389376 c.-121A>C NM_014915.2
ANKRD26 Chr10:27389380 c.-127_-126delAT NM_014915.2
ANKRD26 Chr10:27389381 c.-126T>C NM_014915.2
ANKRD26 Chr10:27389381 c.-126T>G NM_014915.2
ANKRD26 Chr10:27389382 c.-127A>G NM_014915.2
ANKRD26 Chr10:27389382 c.-127A>T NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>T NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>A NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>C NM_014915.2
ANKRD26 Chr10:27389389 c.-134G>A NM_014915.2 rs863223318
APC Chr5:112043009-112043595
APC Chr5:112043220 c.-195A>C NM_001127511.2
APC Chr5:112043223 c.-192A>G/T NM_001127511.2
APC Chr5:112043223 c.-192A>G NM_001127511.2 rs879253784
APC Chr5:112043223 c.-192A>T NM_001127511.2
APC Chr5:112043224 c.-191T>C NM_001127511.2
APC Chr5:112043225 c.-190G>A NM_001127511.2
APC Chr5:112043289 c.-125delA NM_001127511.2
APC Chr5:112072710-112073585
APC Chr5:112111314 c.423-12A>G NM_000038.5
APC Chr5:112111315 c.423-11A>G NM_000038.5
APC Chr5:112115546 c.532-941G>A NM_000038.5 rs730881227
APC Chr5:112151175 c.835-17A>G NM_000038.5
APC Chr5:112158419 c.1408+731C>T NM_000038.5
APC Chr5:112158423 c.1408+735A>T NM_000038.5
ATM Chr11:108093770 c.-174A>G NM_000051.3
ATM Chr11:108094508 c.-31+595G>A NM_000051.3
ATM Chr11:108098321 c.-30-1G>T NM_000051.3 rs869312754
ATM Chr11:108138753 c.2639-384A>G NM_000051.3
ATM Chr11:108141209 c.2839-579_2839-576delAAGT NM_000051.3
ATM Chr11:108151710 c.3403-12T>A NM_000051.3 rs201370733
ATM Chr11:108158168 c.3994-159A>G NM_000051.3 rs864622543
ATM Chr11:108164028 c.4612-12A>G NM_000051.3
ATM Chr11:108179837 c.5763-1050A>G NM_000051.3 rs774925473
ATM Chr11:108214779 c.8418+681A>G NM_000051.3 rs748635985
ATP7B Chr13:52518439 c.3061-12T>A NM_000053.3
ATP7B Chr13:52585551 c.-78A>C NM_000053.3
ATP7B Chr13:52585596 c.-123C>A NM_000053.3
ATP7B Chr13:52585596 c.-128_-124delAGCCG NM_000053.3
ATP7B Chr13:52585606 c.-133A>C NM_000053.3
ATP7B Chr13:52585683 c.-210A>T NM_000053.3
ATP7B Chr13:52585894 NM_000053.3 rs1484840087
ATP7B Chr13:52585897 NM_000053.3
ATP7B Chr13:52585915 c.-442G>A NM_000053.3
BAP1 Chr3:52435659 c.*644delG NM_004656.3
BMPR2 Chr2:203241251 c.-947_-946delGCinsAT NM_001204.6 rs1085307144
BMPR2 Chr2:203241851 c.-347C>T NM_001204.6
BMPR2 Chr2:203241919 c.-279C>A NM_001204.6
BMPR2 Chr2:203242106 c.-92C>A NM_001204.6
BMPR2 Chr2:203395505 c.968-12T>G NM_001204.6
BRCA1 Chr17:41196352 c.*1340_*1342delTGT NM_007294.3 rs1281551853
BRCA1 Chr17:41196424 c.*1271T>C NM_007294.3
BRCA1 Chr17:41197167 c.*528G>C NM_007294.3 rs1060504556
BRCA1 Chr17:41197588 c.*103_*106delTGTC NM_007294.3 rs431825382
BRCA1 Chr17:41197637 c.*58C>T NM_007294.3 rs137892861
BRCA1 Chr17:41197859 c.5468-40T>A NM_007294.3 rs80358151
BRCA1 Chr17:41199745 c.5407-25T>A NM_007294.3 rs758780152
BRCA1 Chr17:41201232 c.5333-36_5333-22delTACTGCAGTGATTTT NM_007294.3
BRCA1 Chr17:41206122 c.5277+2916_5277+2946delAAATTCTAGTGCTTTGGATTTTTTCCTCCATinsGG NM_007294.3
BRCA1 Chr17:41209164 c.5194-12G>A NM_007294.3 rs80358079
BRCA1 Chr17:41215994 c.5075-27delA NM_007294.3
BRCA1 Chr17:41251909 c.442-22_442-13delTGTTCTTTAC NM_007294.3 rs879254224
BRCA1 Chr17:41256984 c.213-11T>G NM_007294.3 rs80358061
BRCA1 Chr17:41256985 c.213-12A>G NM_007294.3 rs80358163
BRCA1 Chr17:41256988 c.213-15A>G NM_007294.3
BRCA1 Chr17:41276134 c.-19-2A>G NM_007294.3
BRCA2 Chr13:32889805 c.-40+1G>A NM_000059.3
BRCA2 Chr13:32890469 c.-39-89delC NM_000059.3
BRCA2 Chr13:32890556 c.-39-1_-39delGA NM_000059.3 rs758732038
BRCA2 Chr13:32890558 c.-39-1G>A NM_000059.3 rs1060499566
BRCA2 Chr13:32900222 c.426-12_426-8delGTTTT NM_000059.3 rs276174844
BRCA2 Chr13:32945079 c.8488-14A>G NM_000059.3
BRCA2 Chr13:32953872 c.8954-15T>G NM_000059.3
BRCA2 Chr13:32971007 c.9502-28A>G NM_000059.3 rs397508059
BRCA2 Chr13:32971023 c.9502-12T>G NM_000059.3 rs81002803
BRIP1 Chr17:59858864 c.1629-498A>T NM_032043.2
BTD Chr3:15683399 c.310-15delT NM_000060.2 rs587783008
CAV1 Chr7:116165023 c.-88delC NM_001753.4
CDH1 Chr16:68842843 c.687+92T>A NM_004360.3
CDKN1B Chr12:12870317 c.-454_-451delTTCC NM_004064.3 rs786201010
CDKN2A Chr9:21968346 c.458-105A>G NM_000077.4
CDKN2A Chr9:21973573 c.150+1104C>A NM_000077.4 rs756102261
CDKN2A Chr9:21974401 c.*73+2T>G NM_058197.4
CDKN2A Chr9:21974847 c.-21C>T NM_000077.4
CDKN2A Chr9:21974875 c.-49C>A NM_000077.4 rs1064797383
CDKN2A Chr9:21974882 c.-56G>T NM_000077.4
CDKN2A Chr9:21974916 c.-93_-91delAGG NM_000077.4
COL3A1 Chr2:189872183 c.3256-43T>G NM_000090.3 rs587779667
COL5A1 Chr9:137645685 c.1720-11T>A NM_000093.4 rs863223444
COL5A1 Chr9:137680989 c.2647-12A>G NM_000093.4
COL5A1 Chr9:137686903 c.2701-25T>G NM_000093.4 rs765079080
COL5A1 Chr9:137726806 c.5137-11T>A NM_000093.4 rs183495554
COL5A2 Chr2:189927655 c.1924-11T>C NM_000393.3
CYLD Chr16:50813428 c.1139-148A>G NM_015247.2
DICER1 Chr14:95559038 c.5364+1187T>G NM_177438.2
DMD ChrX:31165653 c.10554-18C>G NM_004006.2
DMD ChrX:31200680 c.9974+175T>A NM_004006.2
DMD ChrX:31224814 c.9564-30A>T NM_004006.2
DMD ChrX:31225211 c.9564-427T>G NM_004006.2
DMD ChrX:31226400 c.9563+1215A>G NM_004006.2
DMD ChrX:31229031 c.9362-1215A>G NM_004006.2
DMD ChrX:31241047 c.9361+117A>G NM_004006.2
DMD ChrX:31279293 c.9225-160A>G NM_004006.2
DMD ChrX:31279418 c.9225-285A>G NM_004006.2
DMD ChrX:31279420 c.9225-287C>A NM_004006.2
DMD ChrX:31279780 c.9225-647A>G NM_004006.2 rs398124091
DMD ChrX:31279781 c.9225-648A>G NM_004006.2 rs398124084
DMD ChrX:31332523 c.9224+9192C>A NM_004006.2
DMD ChrX:31382270 c.9085-15519G>T NM_004006.2
DMD ChrX:31613687 c.8217+32103G>T NM_004006.2
DMD ChrX:31627738 c.8217+18052A>G NM_004006.2
DMD ChrX:31697714 c.7661-11T>C NM_004006.2
DMD ChrX:31983146 c.6614+3310G>T NM_004006.2 rs797045526
DMD ChrX:32305833 c.6118-15A>G NM_004006.2
DMD ChrX:32360414 c.5740-15G>T NM_004006.2
DMD ChrX:32366860 c.5326-215T>G NM_004006.2
DMD ChrX:32379144 c.5325+1743_5325+1760delTATTAAAAAATGGGTAGA NM_004006.2
DMD ChrX:32398808 c.4675-11A>G NM_004006.2
DMD ChrX:32460274 c.3787-843C>A NM_004006.2
DMD ChrX:32470726 c.3603+2053G>C NM_004006.2
DMD ChrX:32479316 c.3432+2240A>G NM_004006.2
DMD ChrX:32479520 c.3432+2036A>G NM_004006.2
DMD ChrX:32669100 c.961-5831C>T NM_004006.2 rs398124099
DMD ChrX:32669194 c.961-5925A>C NM_004006.2
DMD ChrX:32716130 c.832-15A>G NM_004006.2 rs72470513
DMD ChrX:32827744 c.531-16T>A NM_004006.2
DMD ChrX:32827744 c.531-16T>G NM_004006.2
DMD ChrX:32827744 c.531-16T>A/G NM_004006.2
DMD ChrX:32841967 c.265-463A>G NM_004006.2
DMD ChrX:33032666 c.93+5590T>A NM_004006.2
DMD ChrX:33192452 c.31+36947G>A NM_004006.2
DMD ChrX:33229483 c.-54T>A NM_004006.2
DSC2 Chr18:28683379 c.-1445G>C NM_024422.4 rs75494355
EMD ChrX:153608559 c.266-27_266-10delTCTGCTACCGCTGCCCCC NM_000117.2
ENG Chr9:130578354 c.1742-22T>C NM_001114753.2
ENG Chr9:130588962 c.361-11T>A NM_001114753.2
ENG Chr9:130616692 c.-58G>A NM_001114753.2 rs971268057
ENG Chr9:130616761 c.-127C>T NM_001114753.2
ENG Chr9:130616776 c.-142A>T NM_001114753.2
EPCAM Chr2:47606078 c.556-14A>G NM_002354.2 rs376155665
F5 Chr1:169494158 c.5717-12T>A NM_000130.4
F5 Chr1:169521527 c.1296+268A>G NM_000130.4
F5 Chr1:169521984 c.1119-12C>G NM_000130.4
FBN1 Chr15:48707358 c.8051+375G>T NM_000138.4
FBN1 Chr15:48720682 c.6872-14A>G NM_000138.4
FBN1 Chr15:48721629 c.6872-961A>G NM_000138.4
FBN1 Chr15:48739106 c.5672-87A>G NM_000138.4
FBN1 Chr15:48739107 c.5672-88A>G NM_000138.4
FBN1 Chr15:48764885 c.4211-32_4211-13delGAAGAGTAACGTGTGTTTCT NM_000138.4
FBN1 Chr15:48786466 c.2678-15C>A NM_000138.4
FBN1 Chr15:48802380 c.1589-14A>G NM_000138.4
FBN1 Chr15:48818478 c.863-26C>T NM_000138.4
GAA Chr17:78078341 c.-32-13T>G NM_000152.3 rs386834236
GAA Chr17:78078341 c.-32-13T>A NM_000152.3
GAA Chr17:78078351 c.-32-3C>A/G NM_000152.3
GAA Chr17:78078352 c.-32-2A>G NM_000152.3
GAA Chr17:78078353 c.-32-1G>C NM_000152.3
GAA Chr17:78078369 c.-17C>T NM_000152.3
GAA Chr17:78082266 c.1076-22T>G NM_000152.3 rs762260678
GAA Chr17:78090422 c.2190-345A>G NM_000152.3
GAA Chr17:78092432 c.2647-20T>G NM_000152.3
GATA2 Chr3:128202131 c.1017+572C>T NM_032638.4
GATA2 Chr3:128202162 c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC NM_032638.4
GATA2 Chr3:128202171 c.1017+532T>A NM_032638.4
GATA4 Chr8:11561282 c.-989C>T NM_002052.3
GATA4 Chr8:11561369 c.-902G>T NM_002052.3
GATA4 Chr8:11561399 NM_002052.3 rs1195641788
GATA4 Chr8:11612500 c.910-55T>C NM_002052.3
GATA4 Chr8:11612745 c.997+103G>T NM_002052.3 rs113049875
GATA4 Chr8:11614418 c.998-26G>A NM_002052.3
GLA ChrX:100653945 c.640-11T>A NM_000169.2
GLA ChrX:100654735 c.640-801G>A NM_000169.2 rs199473684
GLA ChrX:100654793 c.640-859C>T NM_000169.2 rs869312374
GLA ChrX:100656225 c.547+395G>C NM_000169.2
HFE Chr6:26087649 c.-20G>A NM_000410.3 rs138378000
HNF1A Chr12:121416034 c.-538G>C NM_000545.5
HNF1A Chr12:121416110 c.-462G>A NM_000545.5
HNF1A Chr12:121416281 c.-291T>C NM_000545.5 rs534474388
HNF1A Chr12:121416285 c.-287G>A NM_000545.5
HNF1A Chr12:121416285 NM_000545.5
HNF1A Chr12:121416289 c.-283A>C NM_000545.5
HNF1A Chr12:121416314 c.-258A>G NM_000545.5 rs756136537
HNF1A Chr12:121416354 c.-218T>C NM_000545.5
HNF1A Chr12:121416385 NM_000545.5
HNF1A Chr12:121416385 NM_000545.5 rs970766228
HNF1A Chr12:121416385 c.-187C>A/T NM_000545.5
HNF1A Chr12:121416391 NM_000545.5
HNF1A Chr12:121416437 NM_000545.5
HNF1A Chr12:121416446 NM_000545.5 rs780586155
HNF1A Chr12:121416453 c.-119G>A NM_000545.5 rs371945966
HNF1A Chr12:121416475 c.-97T>G NM_000545.5
HNF1A Chr12:121416508 NM_000545.5
KCNH2 Chr7:150646165 c.2399-28A>G NM_000238.3
KCNQ1 Chr11:2484803 rs2074238
LDLR Chr19:11199939 NM_000527.4
LDLR Chr19:11199958 c.-267A>G NM_000527.4
LDLR Chr19:11199997 c.-228G>C NM_000527.4 rs376713337
LDLR Chr19:11200000 NM_000527.4
LDLR Chr19:11200019 c.-206C>T NM_000527.4 rs549995837
LDLR Chr19:11200031 NM_000527.4 rs1270618112
LDLR Chr19:11200032 NM_000527.4 rs879254362
LDLR Chr19:11200032 NM_000527.4
LDLR Chr19:11200034 c.-191C>A NM_000527.4
LDLR Chr19:11200037 c.-188C>T NM_000527.4
LDLR Chr19:11200038 c.-185_-183delCTT NM_000527.4
LDLR Chr19:11200053 c.-172G>A NM_000527.4
LDLR Chr19:11200057 c.-168A>G NM_000527.4
LDLR Chr19:11200062 c.-163T>C NM_000527.4
LDLR Chr19:11200064 c.-161A>C NM_000527.4
LDLR Chr19:11200069 c.-156C>T NM_000527.4
LDLR Chr19:11200069 c.-155_-154delACinsTTCTGCAAACTCCT NM_000527.4
LDLR Chr19:11200069 c.-155_-150delACCCCA NM_000527.4
LDLR Chr19:11200070 c.-155_-154delACinsTTCTGCAAACTCCT NM_000527.4 rs879254365
LDLR Chr19:11200070 c.-155_-150delACCCCAinsTT NM_000527.4
LDLR Chr19:11200071 c.-154C>T NM_000527.4
LDLR Chr19:11200072 c.-153C>T NM_000527.4
LDLR Chr19:11200073 c.-152C>T NM_000527.4
LDLR Chr19:11200074 c.-151C>G NM_000527.4
LDLR Chr19:11200075 c.-150A>G NM_000527.4
LDLR Chr19:11200076 c.-149C>A NM_000527.4
LDLR Chr19:11200079 c.-146C>A NM_000527.4
LDLR Chr19:11200083 c.-142C>G/T NM_000527.4
LDLR Chr19:11200084 c.-139_-130delCTCCCCCTGC NM_000527.4
LDLR Chr19:11200085 c.-140C>A/G/T NM_000527.4 rs875989887
LDLR Chr19:11200086 c.-139C>A/G NM_000527.4
LDLR Chr19:11200086 c.-138delT NM_000527.4 rs387906307
LDLR Chr19:11200087 c.-138T>C NM_000527.4
LDLR Chr19:11200088 c.-137C>T NM_000527.4
LDLR Chr19:11200089 c.-136C>G NM_000527.4 rs879254374
LDLR Chr19:11200089 c.-136C>T NM_000527.4
LDLR Chr19:11200089 c.-136C>G/T NM_000527.4
LDLR Chr19:11200090 c.-135C>G NM_000527.4
LDLR Chr19:11200091 c.-134C>T NM_000527.4
LDLR Chr19:11200098 c.-124dupA NM_000527.4
LDLR Chr19:11200105 c.-120C>T NM_000527.4 rs875989886
LDLR Chr19:11200124 c.-101T>C NM_000527.4 rs747068848
LDLR Chr19:11200126 c.-99A>G NM_000527.4
LDLR Chr19:11200127 c.-98C>T NM_000527.4
LDLR Chr19:11200202 c.-23A>C NM_000527.4 rs763282380
LDLR Chr19:11200202 c.-22delC NM_000527.4 rs879254379
LDLR Chr19:11200211 c.-14C>A NM_000527.4
LDLR Chr19:11218203 c.940+14delC NM_000527.4 rs879254730
LDLR Chr19:11221315 c.941-13T>A NM_000527.4
LDLR Chr19:11224179 c.1359-31_1359-23delGCGCTGATGinsCGGCT NM_000527.4
LDLR Chr19:11224186 c.1359-25A>G NM_000527.4
LDLR Chr19:11227685 c.1845+11C>G NM_000527.4
LDLR Chr19:11227689 c.1845+15C>A NM_000527.4
LDLR Chr19:11231284 c.2140+86C>G NM_000527.4
LDLR Chr19:11231301 c.2140+103G>T NM_000527.4
LDLR Chr19:11242035 c.*43G>A NM_000527.4 rs879254527
LDLRAP1 Chr1:25870164 c.-17_-12dupGGCGGC NM_015627.2
LDLRAP1 Chr1:25891056 c.748-608G>A NM_015627.2
LMNA Chr1:156100609 c.513+45T>G NM_170707.3
LMNA Chr1:156105681 c.937-11C>G NM_170707.3 rs267607645
LMNA Chr1:156107037 c.1608+14G>A NM_170707.3
LMNA Chr1:156107433 c.1609-12T>G NM_170707.3 rs267607582
LZTR1 Chr22:21336623 c.-38T>A NM_006767.3
LZTR1 Chr22:21350968 c.2220-17C>A NM_006767.3 rs1249726034
MEN1 Chr11:64571394 c.*412G>A NM_000244.3
MEN1 Chr11:64575165 c.670-15_670-14delTC NM_000244.3
MEN1 Chr11:64577602 c.-23-11_-22delTTGCCTTGCAGGC NM_000244.3
MEN1 Chr11:64577603 c.-23_-22insT NM_000244.3
MEN1 Chr11:64577626 c.-23-22C>A NM_000244.3
MLH1 Chr3:37034619 c.-413_-411delGAG NM_000249.3 rs953169437
MLH1 Chr3:37034932 c.-107C>G NM_000249.3 rs587778886
MLH1 Chr3:37034976 c.-63_-58delGTGATTinsCACGAGGCACGAGCACGA NM_000249.3
MLH1 Chr3:37034997 c.-42C>T NM_000249.3 rs41285097
MLH1 Chr3:37035012 c.-27C>A NM_000249.3 rs587779001
MLH1 Chr3:37035260 c.116+106G>A NM_000249.3
MLH1 Chr3:37038099 c.117-11T>A NM_000249.3 rs267607711
MLH1 Chr3:37050292 c.454-13A>G NM_000249.3 rs267607749
MLH1 Chr3:37061788 c.885-9_887dupTCCTGACAGTTT NM_000249.3 rs63751620
MLH1 Chr3:37070436 c.1558+13T>A NM_000249.3 rs267607834
MSH2 Chr2:47630106 c.-225G>C NM_000251.2 rs138068023
MSH2 Chr2:47630150 c.-181G>A NM_000251.2 rs786201698
MSH2 Chr2:47630249 c.-81dupA NM_000251.2 rs560991330,rs587779187
MSH2 Chr2:47630251 c.-78_-77delTG NM_000251.2 rs587779182
MSH2 Chr2:47698086 c.1662-17dupG NM_000251.2 rs587779099
MSH6 Chr2:48018295 c.457+33_457+34insGTGT NM_000179.2
MSH6 Chr2:48030536 c.3173-16_3173-5delCCCTCTCTTTTA NM_000179.2
MSH6 Chr2:48034014 c.*15A>C NM_000179.2
MSH6 Chr2:48034047 c.*49_*68dupTTCAGACAACATTATGATCT NM_000179.2 rs777409019
MUTYH Chr1:45797534 c.998-13T>G NM_001128425.1
MUTYH Chr1:45798558 c.504+19_504+31delTAGGGGAAATAGG NM_001128425.1 rs781222233
MYBPC3 Chr11:47353394 c.*26+2T>C NM_000256.3
MYBPC3 Chr11:47353821 c.3628-12C>G NM_000256.3 rs371428751
MYBPC3 Chr11:47359371 c.2309-26A>G NM_000256.3
MYBPC3 Chr11:47360310 c.2149-80G>A NM_000256.3
MYBPC3 Chr11:47364709 c.1227-13G>A NM_000256.3 rs397515893
MYBPC3 Chr11:47364832 c.1224-19G>A NM_000256.3 rs587776699
MYBPC3 Chr11:47364865 c.1224-52G>A NM_000256.3 rs786204336
MYBPC3 Chr11:47365750 c.1091-575A>C NM_000256.3
MYBPC3 Chr11:47367305 c.1090+453C>T NM_000256.3
MYBPC3 Chr11:47368602 c.906-22G>A NM_000256.3 rs756267771
MYBPC3 Chr11:47368616 c.906-36G>A NM_000256.3 rs864622197
NEXN Chr1:78381662 c.-52-78C>A NM_144573.3
NF1 Chr17:29422055 c.-273A>C NM_001042492.2
NF1 Chr17:29422056 c.-272G>A NM_001042492.2
NF1 Chr17:29431417 c.60+9031_60+9035delAAGTT NM_001042492.2
NF1 Chr17:29475515 c.61-7486G>T NM_001042492.2
NF1 Chr17:29488136 c.288+2025T>G NM_001042492.2
NF1 Chr17:29508426 c.587-14T>A NM_001042492.2
NF1 Chr17:29508428 c.587-12T>A NM_001042492.2
NF1 Chr17:29510334 c.888+651T>A NM_001042492.2
NF1 Chr17:29510427 c.888+744A>G NM_001042492.2
NF1 Chr17:29510472 c.888+789A>G NM_001042492.2
NF1 Chr17:29527428 c.889-12T>A NM_001042492.2
NF1 Chr17:29530107 c.1260+1604A>G NM_001042492.2
NF1 Chr17:29533239 c.1261-19G>A NM_001042492.2
NF1 Chr17:29534143 c.1392+754T>G NM_001042492.2
NF1 Chr17:29540877 c.1393-592A>G NM_001042492.2
NF1 Chr17:29542762 c.1527+1159C>T NM_001042492.2
NF1 Chr17:29548419 c.1642-449A>G NM_001042492.2 rs863224655
NF1 Chr17:29549489 c.*481A>G NM_001128147.2
NF1 Chr17:29553439 c.2002-14C>G NM_001042492.2
NF1 Chr17:29554225 c.2252-11T>G NM_001042492.2
NF1 Chr17:29556025 c.2410-18C>G NM_001042492.2
NF1 Chr17:29556027 c.2410-16A>G NM_001042492.2
NF1 Chr17:29556028 c.2410-15A>G NM_001042492.2
NF1 Chr17:29556031 c.2410-12T>G NM_001042492.2
NF1 Chr17:29556839 c.2851-14_2851-13insA NM_001042492.2
NF1 Chr17:29557267 c.2991-11T>G NM_001042492.2
NF1 Chr17:29563299 c.3974+260T>G NM_001042492.2
NF1 Chr17:29577082 c.4110+945A>G NM_001042492.2
NF1 Chr17:29580296 c.4173+278A>G NM_001042492.2
NF1 Chr17:29588708 c.4578-20_4578-18delAAG NM_001042492.2
NF1 Chr17:29588715 c.4578-14T>G NM_001042492.2
NF1 Chr17:29654479 c.5269-38A>G NM_001042492.2
NF1 Chr17:29656858 c.5610-456G>T NM_001042492.2
NF1 Chr17:29657848 c.5812+332A>G NM_001042492.2 rs863224491
NF1 Chr17:29661577 c.5813-279A>G NM_001042492.2
NF1 Chr17:29664375 c.6428-11T>G NM_001042492.2
NF1 Chr17:29664618 c.6642+18A>G NM_001042492.2
NF1 Chr17:29676126 c.7190-12T>A NM_001042492.2
NF1 Chr17:29676127 c.7190-11_7190-10insGTTT NM_001042492.2
NF1 Chr17:29685177 c.7971-321C>G NM_001042492.2
NF1 Chr17:29685481 c.7971-17C>G NM_001042492.2
NF1 Chr17:29685665 c.8113+25A>T NM_001042492.2
NF2 Chr22:30050946 c.516+232G>A NM_000268.3
NKX2-5 Chr5:172662741 NM_004387.3
OTC ChrX:38202566 c.-9384G>T NM_000531.5
OTC ChrX:38211584 NM_000531.5 rs191615506
OTC ChrX:38211793 c.-157T>G NM_000531.5
OTC ChrX:38211808 c.-142G>A NM_000531.5
OTC ChrX:38211811 c.-139A>G NM_000531.5
OTC ChrX:38211834 c.-116C>T NM_000531.5
OTC ChrX:38211835 c.-115C>T NM_000531.5
OTC ChrX:38211844 c.-106C>A NM_000531.5 rs749748052
OTC ChrX:38260946 c.540+265G>A NM_000531.5
OTC ChrX:38272343 c.1005+1091C>G NM_000531.5
PALB2 Chr16:23649285 c.109-12T>A NM_024675.3 rs774949203
PCSK9 Chr1:55505180 c.-331C>A NM_174936.3 rs778796405
PDGFRA Chr4:55161473 c.*34G>A NM_006206.4 rs552950826
PLN Chr6:118869382 c.-271A>G NM_002667.4
PLN Chr6:118869417 c.-236C>G NM_002667.4 rs188578681
PMS2 Chr7:6027263 c.1145-31_1145-13delCTGACCCTCTTCTCCGTCC NM_000535.5 rs751973268
PMS2 Chr7:6048599 c.23+21_23+28delTCCGGTGT NM_000535.5
POLE Chr12:133249181 c.1686+32C>G NM_006231.2 rs762985435
PRKAR1A Chr17:66508599 c.-97G>A NM_002734.4
PRKAR1A Chr17:66508689 c.-7G>A NM_002734.4
PRKAR1A Chr17:66508690 c.-7+1G>A NM_002734.4
PRKAR1A Chr17:66521878 c.550-17T>A NM_002734.4
PRKAR1A Chr17:66523964 c.709-7_709-2delTTTTTA NM_002734.4 rs281864801
PROC Chr2:128175983 c.-107A>G NM_000312.3
PROC Chr2:128175984 c.-106A>G NM_000312.3
PROC Chr2:128175988 c.-102T>A NM_000312.3
PROC Chr2:128175991 NM_000312.3
PROC Chr2:128175994 c.-96T>G NM_000312.3
PROC Chr2:128176001 c.-89T>C NM_000312.3
PROC Chr2:128176005 c.-85C>T NM_000312.3
PROC Chr2:128176047 c.-43A>C NM_000312.3
PROC Chr2:128176058 c.-32G>A NM_000312.3 rs912629007
PROC Chr2:128179040 c.237+15G>A NM_000312.3 rs528055589
PROC Chr2:128180582 c.263-28T>G NM_000312.3
PROC Chr2:128180823 c.401-18_401-3delGCCCTCCCCTGCCCGC NM_000312.3
PROC Chr2:128183562 c.536-99C>G NM_000312.3
PROC Chr2:128186595 c.*73C>T NM_000312.3 rs199469473
PROS1 Chr3:93593261 c.1871-20_1871-13delCTAATATT NM_000313.3
PROS1 Chr3:93593263 c.1871-14T>G NM_000313.3 rs754929347
PROS1 Chr3:93598175 c.1493-17T>C NM_000313.3 rs199469501
PROS1 Chr3:93605147 c.1323+33A>G NM_000313.3
PROS1 Chr3:93611983 c.966-17C>G NM_000313.3 rs199469490
PROS1 Chr3:93692761 c.-168C>T NM_000313.3 rs199469484
PROS1 Chr3:93692783 c.-190C>G NM_000313.3 rs149028936
PTCH1 Chr9:98226337 c.2561-2057A>G NM_000264.3
PTEN Chr10:89622883-89623482
PTEN Chr10:89622988 c.-1239A>G NM_000314.6
PTEN Chr10:89623049 c.-1178C>T NM_000314.6
PTEN Chr10:89623056 c.-1171C>T NM_000314.6 rs587779981
PTEN Chr10:89623116 c.-1111A>G NM_000314.6
PTEN Chr10:89623226 c.-1001T>C NM_000314.4
PTEN Chr10:89623296 c.-931G>A NM_000314.4 rs587781959
PTEN Chr10:89623306 c.-921G>T NM_000314.4
PTEN Chr10:89623331 c.-896T>C NM_000314.4
PTEN Chr10:89623365 c.-862G>T NM_000314.4 rs587776675
PTEN Chr10:89623373 c.-854C>G NM_000314.4
PTEN Chr10:89623392 c.-835C>T NM_000314.4 rs587779994
PTEN Chr10:89623428 c.-799G>C NM_000314.4 rs587779992
PTEN Chr10:89623462 c.-765G>A NM_000314.4
PTEN Chr10:89690791 c.210-8dupT NM_000314.4
PTEN Chr10:89692749 c.254-21G>C NM_000314.4
PTEN Chr10:89725294 c.*65T>A NM_000314.4
PTEN Chr10:89725304 c.*75_*92delTAATGGCAATAGGACATTinsCTATGGCAATAGGACATTG NM_000314.4
RB1 Chr13:48877814 NM_000321.2 rs576931877
RB1 Chr13:48877836 NM_000321.2
RB1 Chr13:48877837 c.-212G>A NM_000321.2
RB1 Chr13:48877851 c.-198G>A NM_000321.2 rs387906521
RB1 Chr13:48877851 c.-198G>T NM_000321.2
RB1 Chr13:48877852 c.-197G>A NM_000321.2
RB1 Chr13:48877853 NM_000321.2
RB1 Chr13:48877856 NM_000321.2
RB1 Chr13:48877856 NM_000321.2
RB1 Chr13:48877856 c.-193T>A/G NM_000321.2
RB1 Chr13:48877857 c.-192G>A NM_000321.2
RB1 Chr13:48877860 c.-189G>T NM_000321.2 rs387906520
RB1 Chr13:48877899 c.-150G>C NM_000321.2
RB1 Chr13:48877900 c.-149G>T NM_000321.2
RB1 Chr13:48921946 c.501-15T>G NM_000321.2
RB1 Chr13:48930735 c.608-3418A>G NM_000321.2
RB1 Chr13:48937921 c.861+828T>G NM_000321.2
RB1 Chr13:48947691 c.1215+63T>G NM_000321.2
RB1 Chr13:48954175 c.1390-14A>G NM_000321.2 rs9535023
RB1 Chr13:48954239 c.1421+20_1421+33delTAAAAAATTTTTTT NM_000321.2
RB1 Chr13:49027115 c.1696-14C>T NM_000321.2 rs776912915
RB1 Chr13:49027117 c.1696-12T>G NM_000321.2
RB1 Chr13:49030329 c.1815-11A>G NM_000321.2
RB1 Chr13:49039121 c.2212-13T>A NM_000321.2
RB1 Chr13:49039327 c.2326-14T>C NM_000321.2
RB1 Chr13:49046098 c.2490-1398A>G NM_000321.2
RB1 Chr13:49047468 c.2490-28T>C NM_000321.2
RB1 Chr13:49047470 c.2490-26A>C/G/T NM_000321.2
RB1 Chr13:49047470 c.2490-26A>C NM_000321.2
RB1 Chr13:49047470 c.2490-26A>T NM_000321.2
RB1 Chr13:49047470 c.2490-26A>G NM_000321.2
RET Chr10:43572670 c.-37G>C NM_020975.4 rs751005619
RET Chr10:43572680 c.-27C>G NM_020975.4
RET Chr10:43582162 c.73+9385_73+9395delAGCAACTGCCA NM_020975.4 rs368137511
RET Chr10:43606948 c.1522+35C>T NM_020975.4 rs377130948
RET Chr10:43612192 c.2284+13C>T NM_020975.4
RET Chr10:43612198 c.2284+19C>T NM_020975.4
RET Chr10:43613947 c.2392+19T>C NM_020975.4 rs778745375
RPE65 Chr1:68910577 c.246-11A>G NM_000329.2
RYR1 Chr19:38997317 c.8692+131G>A NM_000540.2
RYR2 Chr1:237730106 c.3423+32dupG NM_001035.2
SCN5A Chr3:38639469 c.2024-11T>A NM_198056.2 rs777987317
SCN5A Chr3:38691021 c.-53+1G>A NM_198056.2
SERPINA1 Chr14:94854894 c.-5+2dupT NM_000295.4
SERPINA1 Chr14:94854896 c.-5+1G>A NM_000295.4 rs775786225
SERPINC1 Chr1:173876666 c.1154-14G>A NM_000488.3
SERPINC1 Chr1:173884075 c.42-18C>G NM_000488.3
SERPINC1 Chr1:173886568 c.-171C>G NM_000488.3
SMARCB1 Chr22:24130008 c.93+559A>G NM_003073.3
SMARCB1 Chr22:24176316 c.1119-12C>G NM_003073.3
SMARCB1 Chr22:24176437 c.*70C>T NM_003073.3
SMARCB1 Chr22:24176449 c.*82C>T NM_003073.3
STK11 Chr19:1220520 c.597+16_597+33delGGGGGGCCCTGGGGCGCCinsTG NM_000455.4
STK11 Chr19:1220530 c.598-32_597+31delGCCCCCTCCCGGGC NM_000455.4
TBX20 Chr7:35293780 c.-549G>A NM_001077653.2 rs571512677
TERC Chr3:169482870 n.-22C>T NR_001566.1
TERC Chr3:169482906 NR_001566.1
TERC Chr3:169482948 n.-100C>G NR_001566.1 rs199422256
TERC Chr3:169483086 NR_001566.1 rs199422255
TERT Chr5:1271334 c.2383-15C>T NM_198253.2 rs574645600
TERT Chr5:1295161 c.-57A>C NM_198253.2
TGFB3 Chr14:76425035 c.*495C>T NM_003239.2 rs387906514
TGFB3 Chr14:76447266 c.-30G>A NM_003239.2 rs770828281
TGFBR2 Chr3:30648317 c.-59C>T NM_001024847.2
TMEM127 Chr2:96931137 c.-18C>T NM_017849.3 rs121908813
TP53 Chr17:7571520 NM_000546.5
TP53 Chr17:7577647 c.673-39G>A NM_000546.5
TP53 Chr17:7579601 c.97-11C>G NM_000546.5
TP53 Chr17:7590694 c.-29+1G>T NM_000546.5
TPM1 Chr15:63349172 c.241-12_241-11delCTinsTG NM_001018005.1 rs199476309
TRDN Chr6:123957870 c.22+29A>G NM_006073.3 rs774068079
TSC1 Chr9:135800306 c.363+668G>A NM_000368.4
TSC2 Chr16:2106052 c.600-145C>T NM_000548.3
TSC2 Chr16:2107460 c.848+281C>T NM_000548.3 rs45517132
TSC2 Chr16:2110656 c.976-15G>A NM_000548.3 rs45517150
TSC2 Chr16:2127477 c.2838-122G>A NM_000548.3
TSC2 Chr16:2138031 c.5069-18A>G NM_000548.3 rs45484794
VHL Chr3:10183453 c.-75_-55delCGCACGCAGCTCCGCCCCGCG NM_000551.3 rs727503744
VHL Chr3:10183471 c.-54_-44dupTCCGACCCGCG NM_000551.3
VHL Chr3:10191719 c.*70C>A NM_000551.3
VHL Chr3:10191719 c.*70C>T NM_000551.3 rs552290225

Conditions screened Genes
Cardiovascular Disease
Aortopathy and connective tissue disorders ACTA2, COL3A1, COL5A1, COL5A2, FBN1, MYH11, MYLK*, PRKG1, SMAD3, TGFB2, TGFB3, TGFBR1, TGFBR2
Cardiomyopathy ACTC1, ACTN2, BAG3, CASZ1, CHRM2, CSRP3, DES, DMD, DSC2, DSG2, DSP, EMD, FHL1*, FLNC*, GAA, GATA4, GLA, JUP, LAMP2, LMNA, LMOD2, MYBPC3, MYH7, MYL2, MYL3, NEXN, NKX2-5, PKP2#*, PLN, PRKAG2, RAF1, RBM20, SGCD, TAB2, TBX20*, TCAP, TMEM43, TNNC1, TNNI3, TNNT2, TPM1, TTN*, TTR, VCL
Channelopathy/Inherited Arrhythmia CACNA1C*, CALM1*, CALM2, CALM3, CASQ2, HCN4, KCNE1, KCNE2, KCNH2, KCNJ2, KCNQ1, RYR2, SCN5A, TECRL, TRDN
Hereditary Hemorrhagic Telangiectasia ACVRL1, ENG, GDF2
Hypercholesterolemia APOB, LDLR, LDLRAP1, PCSK9
Pulmonary Arterial Hypertension BMPR2, CAV1, SMAD4, SMAD9
Pulmonary Fibrosis TERT, TERC, TINF2
Cancer
Breast cancer predisposition syndrome ATM, BARD1, BRCA1*, BRCA2, BRIP1, CHEK2*, NBN, PALB2, RAD50, RAD51C, RAD51D, RECQL*
Endocrinological cancer predisposition syndrome AIP, CDC73, CDKN1B, MAX, MEN1, RET, SDHA*, SDHAF2, SDHB, SDHC, SDHD#, TMEM127
Gastrointestinal/urinary cancer predisposition syndrome APC, AXIN2, BMPR1A*, CDH1, CTNNA1, EPCAM, FH, GREM1, HOXB13, KIT, MET, MLH1, MSH2, MSH6, MUTYH, NTHL1, PDGFRA#, PMS2*, POLD1, POLE, RHBDF2, SMAD4, STK11, VHL, WT1
Hematological cancer predisoposition syndrome ANKRD26, CEBPA, DDX41, EGFR, ERCC6L2, ETV6, GATA2, RUNX1, TERC, TERT, TINF2
Melanoma/cutaneous cancer predisposition syndrome CDK4, CDKN2A, PTCH1, SUFU
Other cancer predisposition syndromes BAP1, CYLD, DICER1*, EXT1, EXT2, FLCN, LZTR1, NF1*, NF2, PHOX2B, POT1, PRKAR1A, PTEN*, RB1, SMARCA4, SMARCB1, TP53, TSC1, TSC2
Other medical disorders
Alpha-1-Antitrypsin SERPINA1
Biotinidase deficiency BTD
Hereditary Hemochromatosis HFE
Aminoglycoside-induced hearing loss MT-RNR1
Liddle syndrome SCNN1B, SCNN1G
Malignant Hyperthermia CACNA1S, RYR1
Maturity onset diabetes of the young (MODY) HNF1A
Ornithine Transcarbamylase deficiency OTC
RPE65-related retinal dystrophy RPE65
Thrombophilia F5, PROC, PROS1*, SERPINC1
Wilson Disease ATP7B

Some genes in the tables above may be associated with more than one genetic condition or hereditary predisposition that may or may not have a different inheritance pattern (eg. variants in the SMAD4 gene are associated with gastrointestinal cancer predisposition and hereditary hemorrhagic telangiectasia). As a result, disease-causing variants (meeting a likely pathogenic or pathogenic classification) that are associated with conditions other than those specifically listed may still be included in a patient’s report.

In addition, carrier status (defined as a single disease-causing variant in a gene associated with autosomal recessive inheritance) will be reported as an incidental finding (under the “Carriership of autosomal recessive disease” heading) on the patient’s report

# The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.

* Some, or all, of the gene is duplicated in the genome. Read more.

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.

Non-coding variants covered by Comprehensive Proactive Screen

To view complete table content, scroll horizontally.

Gene Genomic location HG19 HGVS RefSeq RS-number
ACTC1 Chr15:35080829 c.*1784T>C NM_005159.4
ACVRL1 Chr12:52314269 c.1378-274C>G NM_000020.2
ACVRL1 Chr12:52314327 c.1378-216C>G NM_000020.2
ACVRL1 Chr12:52314387 c.1378-156_1378-155invCT NM_000020.2
ACVRL1 Chr12:52314412 c.1378-131C>G NM_000020.2
ACVRL1 Chr12:52314465 c.1378-78T>G NM_000020.2
ACVRL1 Chr12:52314474 c.1378-69C>A NM_000020.2
AIP Chr11:67250360 NM_003977.2 rs267606588
AIP Chr11:67250410 c.-220G>A NM_003977.2 rs267606540
ANKRD26 Chr10:27389371 c.-116C>G NM_014915.2
ANKRD26 Chr10:27389373 c.-118C>A NM_014915.2
ANKRD26 Chr10:27389374 c.-119C>A NM_014915.2
ANKRD26 Chr10:27389374 c.-119C>A/G NM_014915.2
ANKRD26 Chr10:27389376 c.-121A>C NM_014915.2
ANKRD26 Chr10:27389380 c.-127_-126delAT NM_014915.2
ANKRD26 Chr10:27389381 c.-126T>C NM_014915.2
ANKRD26 Chr10:27389381 c.-126T>G NM_014915.2
ANKRD26 Chr10:27389382 c.-127A>G NM_014915.2
ANKRD26 Chr10:27389382 c.-127A>T NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>T NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>A NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>C NM_014915.2
ANKRD26 Chr10:27389389 c.-134G>A NM_014915.2 rs863223318
APC Chr5:112043009-112043595
APC Chr5:112043220 c.-195A>C NM_001127511.2
APC Chr5:112043223 c.-192A>G/T NM_001127511.2
APC Chr5:112043223 c.-192A>G NM_001127511.2 rs879253784
APC Chr5:112043223 c.-192A>T NM_001127511.2
APC Chr5:112043224 c.-191T>C NM_001127511.2
APC Chr5:112043225 c.-190G>A NM_001127511.2
APC Chr5:112043289 c.-125delA NM_001127511.2
APC Chr5:112072710-112073585
APC Chr5:112111314 c.423-12A>G NM_000038.5
APC Chr5:112111315 c.423-11A>G NM_000038.5
APC Chr5:112115546 c.532-941G>A NM_000038.5 rs730881227
APC Chr5:112151175 c.835-17A>G NM_000038.5
APC Chr5:112158419 c.1408+731C>T NM_000038.5
APC Chr5:112158423 c.1408+735A>T NM_000038.5
ATM Chr11:108093770 c.-174A>G NM_000051.3
ATM Chr11:108094508 c.-31+595G>A NM_000051.3
ATM Chr11:108098321 c.-30-1G>T NM_000051.3 rs869312754
ATM Chr11:108138753 c.2639-384A>G NM_000051.3
ATM Chr11:108141209 c.2839-579_2839-576delAAGT NM_000051.3
ATM Chr11:108151710 c.3403-12T>A NM_000051.3 rs201370733
ATM Chr11:108158168 c.3994-159A>G NM_000051.3 rs864622543
ATM Chr11:108164028 c.4612-12A>G NM_000051.3
ATM Chr11:108179837 c.5763-1050A>G NM_000051.3 rs774925473
ATM Chr11:108214779 c.8418+681A>G NM_000051.3 rs748635985
ATP7B Chr13:52518439 c.3061-12T>A NM_000053.3
ATP7B Chr13:52585551 c.-78A>C NM_000053.3
ATP7B Chr13:52585596 c.-123C>A NM_000053.3
ATP7B Chr13:52585596 c.-128_-124delAGCCG NM_000053.3
ATP7B Chr13:52585606 c.-133A>C NM_000053.3
ATP7B Chr13:52585683 c.-210A>T NM_000053.3
ATP7B Chr13:52585894 NM_000053.3 rs1484840087
ATP7B Chr13:52585897 NM_000053.3
ATP7B Chr13:52585915 c.-442G>A NM_000053.3
BAP1 Chr3:52435659 c.*644delG NM_004656.3
BMPR2 Chr2:203241251 c.-947_-946delGCinsAT NM_001204.6 rs1085307144
BMPR2 Chr2:203241851 c.-347C>T NM_001204.6
BMPR2 Chr2:203241919 c.-279C>A NM_001204.6
BMPR2 Chr2:203242106 c.-92C>A NM_001204.6
BMPR2 Chr2:203395505 c.968-12T>G NM_001204.6
BRCA1 Chr17:41196352 c.*1340_*1342delTGT NM_007294.3 rs1281551853
BRCA1 Chr17:41196424 c.*1271T>C NM_007294.3
BRCA1 Chr17:41197167 c.*528G>C NM_007294.3 rs1060504556
BRCA1 Chr17:41197588 c.*103_*106delTGTC NM_007294.3 rs431825382
BRCA1 Chr17:41197637 c.*58C>T NM_007294.3 rs137892861
BRCA1 Chr17:41197859 c.5468-40T>A NM_007294.3 rs80358151
BRCA1 Chr17:41199745 c.5407-25T>A NM_007294.3 rs758780152
BRCA1 Chr17:41201232 c.5333-36_5333-22delTACTGCAGTGATTTT NM_007294.3
BRCA1 Chr17:41206122 c.5277+2916_5277+2946delAAATTCTAGTGCTTTGGATTTTTTCCTCCATinsGG NM_007294.3
BRCA1 Chr17:41209164 c.5194-12G>A NM_007294.3 rs80358079
BRCA1 Chr17:41215994 c.5075-27delA NM_007294.3
BRCA1 Chr17:41251909 c.442-22_442-13delTGTTCTTTAC NM_007294.3 rs879254224
BRCA1 Chr17:41256984 c.213-11T>G NM_007294.3 rs80358061
BRCA1 Chr17:41256985 c.213-12A>G NM_007294.3 rs80358163
BRCA1 Chr17:41256988 c.213-15A>G NM_007294.3
BRCA1 Chr17:41276134 c.-19-2A>G NM_007294.3
BRCA2 Chr13:32889805 c.-40+1G>A NM_000059.3
BRCA2 Chr13:32890469 c.-39-89delC NM_000059.3
BRCA2 Chr13:32890556 c.-39-1_-39delGA NM_000059.3 rs758732038
BRCA2 Chr13:32890558 c.-39-1G>A NM_000059.3 rs1060499566
BRCA2 Chr13:32900222 c.426-12_426-8delGTTTT NM_000059.3 rs276174844
BRCA2 Chr13:32945079 c.8488-14A>G NM_000059.3
BRCA2 Chr13:32953872 c.8954-15T>G NM_000059.3
BRCA2 Chr13:32971007 c.9502-28A>G NM_000059.3 rs397508059
BRCA2 Chr13:32971023 c.9502-12T>G NM_000059.3 rs81002803
BRIP1 Chr17:59858864 c.1629-498A>T NM_032043.2
BTD Chr3:15683399 c.310-15delT NM_000060.2 rs587783008
CAV1 Chr7:116165023 c.-88delC NM_001753.4
CDH1 Chr16:68842843 c.687+92T>A NM_004360.3
CDKN1B Chr12:12870317 c.-454_-451delTTCC NM_004064.3 rs786201010
CDKN2A Chr9:21968346 c.458-105A>G NM_000077.4
CDKN2A Chr9:21973573 c.150+1104C>A NM_000077.4 rs756102261
CDKN2A Chr9:21974401 c.*73+2T>G NM_058197.4
CDKN2A Chr9:21974847 c.-21C>T NM_000077.4
CDKN2A Chr9:21974875 c.-49C>A NM_000077.4 rs1064797383
CDKN2A Chr9:21974882 c.-56G>T NM_000077.4
CDKN2A Chr9:21974916 c.-93_-91delAGG NM_000077.4
COL3A1 Chr2:189872183 c.3256-43T>G NM_000090.3 rs587779667
COL5A1 Chr9:137645685 c.1720-11T>A NM_000093.4 rs863223444
COL5A1 Chr9:137680989 c.2647-12A>G NM_000093.4
COL5A1 Chr9:137686903 c.2701-25T>G NM_000093.4 rs765079080
COL5A1 Chr9:137726806 c.5137-11T>A NM_000093.4 rs183495554
COL5A2 Chr2:189927655 c.1924-11T>C NM_000393.3
CYLD Chr16:50813428 c.1139-148A>G NM_015247.2
DICER1 Chr14:95559038 c.5364+1187T>G NM_177438.2
DMD ChrX:31165653 c.10554-18C>G NM_004006.2
DMD ChrX:31200680 c.9974+175T>A NM_004006.2
DMD ChrX:31224814 c.9564-30A>T NM_004006.2
DMD ChrX:31225211 c.9564-427T>G NM_004006.2
DMD ChrX:31226400 c.9563+1215A>G NM_004006.2
DMD ChrX:31229031 c.9362-1215A>G NM_004006.2
DMD ChrX:31241047 c.9361+117A>G NM_004006.2
DMD ChrX:31279293 c.9225-160A>G NM_004006.2
DMD ChrX:31279418 c.9225-285A>G NM_004006.2
DMD ChrX:31279420 c.9225-287C>A NM_004006.2
DMD ChrX:31279780 c.9225-647A>G NM_004006.2 rs398124091
DMD ChrX:31279781 c.9225-648A>G NM_004006.2 rs398124084
DMD ChrX:31332523 c.9224+9192C>A NM_004006.2
DMD ChrX:31382270 c.9085-15519G>T NM_004006.2
DMD ChrX:31613687 c.8217+32103G>T NM_004006.2
DMD ChrX:31627738 c.8217+18052A>G NM_004006.2
DMD ChrX:31697714 c.7661-11T>C NM_004006.2
DMD ChrX:31983146 c.6614+3310G>T NM_004006.2 rs797045526
DMD ChrX:32305833 c.6118-15A>G NM_004006.2
DMD ChrX:32360414 c.5740-15G>T NM_004006.2
DMD ChrX:32366860 c.5326-215T>G NM_004006.2
DMD ChrX:32379144 c.5325+1743_5325+1760delTATTAAAAAATGGGTAGA NM_004006.2
DMD ChrX:32398808 c.4675-11A>G NM_004006.2
DMD ChrX:32460274 c.3787-843C>A NM_004006.2
DMD ChrX:32470726 c.3603+2053G>C NM_004006.2
DMD ChrX:32479316 c.3432+2240A>G NM_004006.2
DMD ChrX:32479520 c.3432+2036A>G NM_004006.2
DMD ChrX:32669100 c.961-5831C>T NM_004006.2 rs398124099
DMD ChrX:32669194 c.961-5925A>C NM_004006.2
DMD ChrX:32716130 c.832-15A>G NM_004006.2 rs72470513
DMD ChrX:32827744 c.531-16T>A NM_004006.2
DMD ChrX:32827744 c.531-16T>G NM_004006.2
DMD ChrX:32827744 c.531-16T>A/G NM_004006.2
DMD ChrX:32841967 c.265-463A>G NM_004006.2
DMD ChrX:33032666 c.93+5590T>A NM_004006.2
DMD ChrX:33192452 c.31+36947G>A NM_004006.2
DMD ChrX:33229483 c.-54T>A NM_004006.2
DSC2 Chr18:28683379 c.-1445G>C NM_024422.4 rs75494355
EMD ChrX:153608559 c.266-27_266-10delTCTGCTACCGCTGCCCCC NM_000117.2
ENG Chr9:130578354 c.1742-22T>C NM_001114753.2
ENG Chr9:130588962 c.361-11T>A NM_001114753.2
ENG Chr9:130616692 c.-58G>A NM_001114753.2 rs971268057
ENG Chr9:130616761 c.-127C>T NM_001114753.2
ENG Chr9:130616776 c.-142A>T NM_001114753.2
EPCAM Chr2:47606078 c.556-14A>G NM_002354.2 rs376155665
F5 Chr1:169494158 c.5717-12T>A NM_000130.4
F5 Chr1:169521527 c.1296+268A>G NM_000130.4
F5 Chr1:169521984 c.1119-12C>G NM_000130.4
FBN1 Chr15:48707358 c.8051+375G>T NM_000138.4
FBN1 Chr15:48720682 c.6872-14A>G NM_000138.4
FBN1 Chr15:48721629 c.6872-961A>G NM_000138.4
FBN1 Chr15:48739106 c.5672-87A>G NM_000138.4
FBN1 Chr15:48739107 c.5672-88A>G NM_000138.4
FBN1 Chr15:48764885 c.4211-32_4211-13delGAAGAGTAACGTGTGTTTCT NM_000138.4
FBN1 Chr15:48786466 c.2678-15C>A NM_000138.4
FBN1 Chr15:48802380 c.1589-14A>G NM_000138.4
FBN1 Chr15:48818478 c.863-26C>T NM_000138.4
GAA Chr17:78078341 c.-32-13T>G NM_000152.3 rs386834236
GAA Chr17:78078341 c.-32-13T>A NM_000152.3
GAA Chr17:78078351 c.-32-3C>A/G NM_000152.3
GAA Chr17:78078352 c.-32-2A>G NM_000152.3
GAA Chr17:78078353 c.-32-1G>C NM_000152.3
GAA Chr17:78078369 c.-17C>T NM_000152.3
GAA Chr17:78082266 c.1076-22T>G NM_000152.3 rs762260678
GAA Chr17:78090422 c.2190-345A>G NM_000152.3
GAA Chr17:78092432 c.2647-20T>G NM_000152.3
GATA2 Chr3:128202131 c.1017+572C>T NM_032638.4
GATA2 Chr3:128202162 c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC NM_032638.4
GATA2 Chr3:128202171 c.1017+532T>A NM_032638.4
GATA4 Chr8:11561282 c.-989C>T NM_002052.3
GATA4 Chr8:11561369 c.-902G>T NM_002052.3
GATA4 Chr8:11561399 NM_002052.3 rs1195641788
GATA4 Chr8:11612500 c.910-55T>C NM_002052.3
GATA4 Chr8:11612745 c.997+103G>T NM_002052.3 rs113049875
GATA4 Chr8:11614418 c.998-26G>A NM_002052.3
GLA ChrX:100653945 c.640-11T>A NM_000169.2
GLA ChrX:100654735 c.640-801G>A NM_000169.2 rs199473684
GLA ChrX:100654793 c.640-859C>T NM_000169.2 rs869312374
GLA ChrX:100656225 c.547+395G>C NM_000169.2
HFE Chr6:26087649 c.-20G>A NM_000410.3 rs138378000
HNF1A Chr12:121416034 c.-538G>C NM_000545.5
HNF1A Chr12:121416110 c.-462G>A NM_000545.5
HNF1A Chr12:121416281 c.-291T>C NM_000545.5 rs534474388
HNF1A Chr12:121416285 c.-287G>A NM_000545.5
HNF1A Chr12:121416285 NM_000545.5
HNF1A Chr12:121416289 c.-283A>C NM_000545.5
HNF1A Chr12:121416314 c.-258A>G NM_000545.5 rs756136537
HNF1A Chr12:121416354 c.-218T>C NM_000545.5
HNF1A Chr12:121416385 NM_000545.5
HNF1A Chr12:121416385 NM_000545.5 rs970766228
HNF1A Chr12:121416385 c.-187C>A/T NM_000545.5
HNF1A Chr12:121416391 NM_000545.5
HNF1A Chr12:121416437 NM_000545.5
HNF1A Chr12:121416446 NM_000545.5 rs780586155
HNF1A Chr12:121416453 c.-119G>A NM_000545.5 rs371945966
HNF1A Chr12:121416475 c.-97T>G NM_000545.5
HNF1A Chr12:121416508 NM_000545.5
KCNH2 Chr7:150646165 c.2399-28A>G NM_000238.3
KCNQ1 Chr11:2484803 rs2074238
LDLR Chr19:11199939 NM_000527.4
LDLR Chr19:11199958 c.-267A>G NM_000527.4
LDLR Chr19:11199997 c.-228G>C NM_000527.4 rs376713337
LDLR Chr19:11200000 NM_000527.4
LDLR Chr19:11200019 c.-206C>T NM_000527.4 rs549995837
LDLR Chr19:11200031 NM_000527.4 rs1270618112
LDLR Chr19:11200032 NM_000527.4 rs879254362
LDLR Chr19:11200032 NM_000527.4
LDLR Chr19:11200034 c.-191C>A NM_000527.4
LDLR Chr19:11200037 c.-188C>T NM_000527.4
LDLR Chr19:11200038 c.-185_-183delCTT NM_000527.4
LDLR Chr19:11200053 c.-172G>A NM_000527.4
LDLR Chr19:11200057 c.-168A>G NM_000527.4
LDLR Chr19:11200062 c.-163T>C NM_000527.4
LDLR Chr19:11200064 c.-161A>C NM_000527.4
LDLR Chr19:11200069 c.-156C>T NM_000527.4
LDLR Chr19:11200069 c.-155_-154delACinsTTCTGCAAACTCCT NM_000527.4
LDLR Chr19:11200069 c.-155_-150delACCCCA NM_000527.4
LDLR Chr19:11200070 c.-155_-154delACinsTTCTGCAAACTCCT NM_000527.4 rs879254365
LDLR Chr19:11200070 c.-155_-150delACCCCAinsTT NM_000527.4
LDLR Chr19:11200071 c.-154C>T NM_000527.4
LDLR Chr19:11200072 c.-153C>T NM_000527.4
LDLR Chr19:11200073 c.-152C>T NM_000527.4
LDLR Chr19:11200074 c.-151C>G NM_000527.4
LDLR Chr19:11200075 c.-150A>G NM_000527.4
LDLR Chr19:11200076 c.-149C>A NM_000527.4
LDLR Chr19:11200079 c.-146C>A NM_000527.4
LDLR Chr19:11200083 c.-142C>G/T NM_000527.4
LDLR Chr19:11200084 c.-139_-130delCTCCCCCTGC NM_000527.4
LDLR Chr19:11200085 c.-140C>A/G/T NM_000527.4 rs875989887
LDLR Chr19:11200086 c.-139C>A/G NM_000527.4
LDLR Chr19:11200086 c.-138delT NM_000527.4 rs387906307
LDLR Chr19:11200087 c.-138T>C NM_000527.4
LDLR Chr19:11200088 c.-137C>T NM_000527.4
LDLR Chr19:11200089 c.-136C>G NM_000527.4 rs879254374
LDLR Chr19:11200089 c.-136C>T NM_000527.4
LDLR Chr19:11200089 c.-136C>G/T NM_000527.4
LDLR Chr19:11200090 c.-135C>G NM_000527.4
LDLR Chr19:11200091 c.-134C>T NM_000527.4
LDLR Chr19:11200098 c.-124dupA NM_000527.4
LDLR Chr19:11200105 c.-120C>T NM_000527.4 rs875989886
LDLR Chr19:11200124 c.-101T>C NM_000527.4 rs747068848
LDLR Chr19:11200126 c.-99A>G NM_000527.4
LDLR Chr19:11200127 c.-98C>T NM_000527.4
LDLR Chr19:11200202 c.-23A>C NM_000527.4 rs763282380
LDLR Chr19:11200202 c.-22delC NM_000527.4 rs879254379
LDLR Chr19:11200211 c.-14C>A NM_000527.4
LDLR Chr19:11218203 c.940+14delC NM_000527.4 rs879254730
LDLR Chr19:11221315 c.941-13T>A NM_000527.4
LDLR Chr19:11224179 c.1359-31_1359-23delGCGCTGATGinsCGGCT NM_000527.4
LDLR Chr19:11224186 c.1359-25A>G NM_000527.4
LDLR Chr19:11227685 c.1845+11C>G NM_000527.4
LDLR Chr19:11227689 c.1845+15C>A NM_000527.4
LDLR Chr19:11231284 c.2140+86C>G NM_000527.4
LDLR Chr19:11231301 c.2140+103G>T NM_000527.4
LDLR Chr19:11242035 c.*43G>A NM_000527.4 rs879254527
LDLRAP1 Chr1:25870164 c.-17_-12dupGGCGGC NM_015627.2
LDLRAP1 Chr1:25891056 c.748-608G>A NM_015627.2
LMNA Chr1:156100609 c.513+45T>G NM_170707.3
LMNA Chr1:156105681 c.937-11C>G NM_170707.3 rs267607645
LMNA Chr1:156107037 c.1608+14G>A NM_170707.3
LMNA Chr1:156107433 c.1609-12T>G NM_170707.3 rs267607582
LZTR1 Chr22:21336623 c.-38T>A NM_006767.3
LZTR1 Chr22:21350968 c.2220-17C>A NM_006767.3 rs1249726034
MEN1 Chr11:64571394 c.*412G>A NM_000244.3
MEN1 Chr11:64575165 c.670-15_670-14delTC NM_000244.3
MEN1 Chr11:64577602 c.-23-11_-22delTTGCCTTGCAGGC NM_000244.3
MEN1 Chr11:64577603 c.-23_-22insT NM_000244.3
MEN1 Chr11:64577626 c.-23-22C>A NM_000244.3
MLH1 Chr3:37034619 c.-413_-411delGAG NM_000249.3 rs953169437
MLH1 Chr3:37034932 c.-107C>G NM_000249.3 rs587778886
MLH1 Chr3:37034976 c.-63_-58delGTGATTinsCACGAGGCACGAGCACGA NM_000249.3
MLH1 Chr3:37034997 c.-42C>T NM_000249.3 rs41285097
MLH1 Chr3:37035012 c.-27C>A NM_000249.3 rs587779001
MLH1 Chr3:37035260 c.116+106G>A NM_000249.3
MLH1 Chr3:37038099 c.117-11T>A NM_000249.3 rs267607711
MLH1 Chr3:37050292 c.454-13A>G NM_000249.3 rs267607749
MLH1 Chr3:37061788 c.885-9_887dupTCCTGACAGTTT NM_000249.3 rs63751620
MLH1 Chr3:37070436 c.1558+13T>A NM_000249.3 rs267607834
MSH2 Chr2:47630106 c.-225G>C NM_000251.2 rs138068023
MSH2 Chr2:47630150 c.-181G>A NM_000251.2 rs786201698
MSH2 Chr2:47630249 c.-81dupA NM_000251.2 rs560991330,rs587779187
MSH2 Chr2:47630251 c.-78_-77delTG NM_000251.2 rs587779182
MSH2 Chr2:47698086 c.1662-17dupG NM_000251.2 rs587779099
MSH6 Chr2:48018295 c.457+33_457+34insGTGT NM_000179.2
MSH6 Chr2:48030536 c.3173-16_3173-5delCCCTCTCTTTTA NM_000179.2
MSH6 Chr2:48034014 c.*15A>C NM_000179.2
MSH6 Chr2:48034047 c.*49_*68dupTTCAGACAACATTATGATCT NM_000179.2 rs777409019
MUTYH Chr1:45797534 c.998-13T>G NM_001128425.1
MUTYH Chr1:45798558 c.504+19_504+31delTAGGGGAAATAGG NM_001128425.1 rs781222233
MYBPC3 Chr11:47353394 c.*26+2T>C NM_000256.3
MYBPC3 Chr11:47353821 c.3628-12C>G NM_000256.3 rs371428751
MYBPC3 Chr11:47359371 c.2309-26A>G NM_000256.3
MYBPC3 Chr11:47360310 c.2149-80G>A NM_000256.3
MYBPC3 Chr11:47364709 c.1227-13G>A NM_000256.3 rs397515893
MYBPC3 Chr11:47364832 c.1224-19G>A NM_000256.3 rs587776699
MYBPC3 Chr11:47364865 c.1224-52G>A NM_000256.3 rs786204336
MYBPC3 Chr11:47365750 c.1091-575A>C NM_000256.3
MYBPC3 Chr11:47367305 c.1090+453C>T NM_000256.3
MYBPC3 Chr11:47368602 c.906-22G>A NM_000256.3 rs756267771
MYBPC3 Chr11:47368616 c.906-36G>A NM_000256.3 rs864622197
NEXN Chr1:78381662 c.-52-78C>A NM_144573.3
NF1 Chr17:29422055 c.-273A>C NM_001042492.2
NF1 Chr17:29422056 c.-272G>A NM_001042492.2
NF1 Chr17:29431417 c.60+9031_60+9035delAAGTT NM_001042492.2
NF1 Chr17:29475515 c.61-7486G>T NM_001042492.2
NF1 Chr17:29488136 c.288+2025T>G NM_001042492.2
NF1 Chr17:29508426 c.587-14T>A NM_001042492.2
NF1 Chr17:29508428 c.587-12T>A NM_001042492.2
NF1 Chr17:29510334 c.888+651T>A NM_001042492.2
NF1 Chr17:29510427 c.888+744A>G NM_001042492.2
NF1 Chr17:29510472 c.888+789A>G NM_001042492.2
NF1 Chr17:29527428 c.889-12T>A NM_001042492.2
NF1 Chr17:29530107 c.1260+1604A>G NM_001042492.2
NF1 Chr17:29533239 c.1261-19G>A NM_001042492.2
NF1 Chr17:29534143 c.1392+754T>G NM_001042492.2
NF1 Chr17:29540877 c.1393-592A>G NM_001042492.2
NF1 Chr17:29542762 c.1527+1159C>T NM_001042492.2
NF1 Chr17:29548419 c.1642-449A>G NM_001042492.2 rs863224655
NF1 Chr17:29549489 c.*481A>G NM_001128147.2
NF1 Chr17:29553439 c.2002-14C>G NM_001042492.2
NF1 Chr17:29554225 c.2252-11T>G NM_001042492.2
NF1 Chr17:29556025 c.2410-18C>G NM_001042492.2
NF1 Chr17:29556027 c.2410-16A>G NM_001042492.2
NF1 Chr17:29556028 c.2410-15A>G NM_001042492.2
NF1 Chr17:29556031 c.2410-12T>G NM_001042492.2
NF1 Chr17:29556839 c.2851-14_2851-13insA NM_001042492.2
NF1 Chr17:29557267 c.2991-11T>G NM_001042492.2
NF1 Chr17:29563299 c.3974+260T>G NM_001042492.2
NF1 Chr17:29577082 c.4110+945A>G NM_001042492.2
NF1 Chr17:29580296 c.4173+278A>G NM_001042492.2
NF1 Chr17:29588708 c.4578-20_4578-18delAAG NM_001042492.2
NF1 Chr17:29588715 c.4578-14T>G NM_001042492.2
NF1 Chr17:29654479 c.5269-38A>G NM_001042492.2
NF1 Chr17:29656858 c.5610-456G>T NM_001042492.2
NF1 Chr17:29657848 c.5812+332A>G NM_001042492.2 rs863224491
NF1 Chr17:29661577 c.5813-279A>G NM_001042492.2
NF1 Chr17:29664375 c.6428-11T>G NM_001042492.2
NF1 Chr17:29664618 c.6642+18A>G NM_001042492.2
NF1 Chr17:29676126 c.7190-12T>A NM_001042492.2
NF1 Chr17:29676127 c.7190-11_7190-10insGTTT NM_001042492.2
NF1 Chr17:29685177 c.7971-321C>G NM_001042492.2
NF1 Chr17:29685481 c.7971-17C>G NM_001042492.2
NF1 Chr17:29685665 c.8113+25A>T NM_001042492.2
NF2 Chr22:30050946 c.516+232G>A NM_000268.3
NKX2-5 Chr5:172662741 NM_004387.3
OTC ChrX:38202566 c.-9384G>T NM_000531.5
OTC ChrX:38211584 NM_000531.5 rs191615506
OTC ChrX:38211793 c.-157T>G NM_000531.5
OTC ChrX:38211808 c.-142G>A NM_000531.5
OTC ChrX:38211811 c.-139A>G NM_000531.5
OTC ChrX:38211834 c.-116C>T NM_000531.5
OTC ChrX:38211835 c.-115C>T NM_000531.5
OTC ChrX:38211844 c.-106C>A NM_000531.5 rs749748052
OTC ChrX:38260946 c.540+265G>A NM_000531.5
OTC ChrX:38272343 c.1005+1091C>G NM_000531.5
PALB2 Chr16:23649285 c.109-12T>A NM_024675.3 rs774949203
PCSK9 Chr1:55505180 c.-331C>A NM_174936.3 rs778796405
PDGFRA Chr4:55161473 c.*34G>A NM_006206.4 rs552950826
PLN Chr6:118869382 c.-271A>G NM_002667.4
PLN Chr6:118869417 c.-236C>G NM_002667.4 rs188578681
PMS2 Chr7:6027263 c.1145-31_1145-13delCTGACCCTCTTCTCCGTCC NM_000535.5 rs751973268
PMS2 Chr7:6048599 c.23+21_23+28delTCCGGTGT NM_000535.5
POLE Chr12:133249181 c.1686+32C>G NM_006231.2 rs762985435
PRKAR1A Chr17:66508599 c.-97G>A NM_002734.4
PRKAR1A Chr17:66508689 c.-7G>A NM_002734.4
PRKAR1A Chr17:66508690 c.-7+1G>A NM_002734.4
PRKAR1A Chr17:66521878 c.550-17T>A NM_002734.4
PRKAR1A Chr17:66523964 c.709-7_709-2delTTTTTA NM_002734.4 rs281864801
PROC Chr2:128175983 c.-107A>G NM_000312.3
PROC Chr2:128175984 c.-106A>G NM_000312.3
PROC Chr2:128175988 c.-102T>A NM_000312.3
PROC Chr2:128175991 NM_000312.3
PROC Chr2:128175994 c.-96T>G NM_000312.3
PROC Chr2:128176001 c.-89T>C NM_000312.3
PROC Chr2:128176005 c.-85C>T NM_000312.3
PROC Chr2:128176047 c.-43A>C NM_000312.3
PROC Chr2:128176058 c.-32G>A NM_000312.3 rs912629007
PROC Chr2:128179040 c.237+15G>A NM_000312.3 rs528055589
PROC Chr2:128180582 c.263-28T>G NM_000312.3
PROC Chr2:128180823 c.401-18_401-3delGCCCTCCCCTGCCCGC NM_000312.3
PROC Chr2:128183562 c.536-99C>G NM_000312.3
PROC Chr2:128186595 c.*73C>T NM_000312.3 rs199469473
PROS1 Chr3:93593261 c.1871-20_1871-13delCTAATATT NM_000313.3
PROS1 Chr3:93593263 c.1871-14T>G NM_000313.3 rs754929347
PROS1 Chr3:93598175 c.1493-17T>C NM_000313.3 rs199469501
PROS1 Chr3:93605147 c.1323+33A>G NM_000313.3
PROS1 Chr3:93611983 c.966-17C>G NM_000313.3 rs199469490
PROS1 Chr3:93692761 c.-168C>T NM_000313.3 rs199469484
PROS1 Chr3:93692783 c.-190C>G NM_000313.3 rs149028936
PTCH1 Chr9:98226337 c.2561-2057A>G NM_000264.3
PTEN Chr10:89622883-89623482
PTEN Chr10:89622988 c.-1239A>G NM_000314.6
PTEN Chr10:89623049 c.-1178C>T NM_000314.6
PTEN Chr10:89623056 c.-1171C>T NM_000314.6 rs587779981
PTEN Chr10:89623116 c.-1111A>G NM_000314.6
PTEN Chr10:89623226 c.-1001T>C NM_000314.4
PTEN Chr10:89623296 c.-931G>A NM_000314.4 rs587781959
PTEN Chr10:89623306 c.-921G>T NM_000314.4
PTEN Chr10:89623331 c.-896T>C NM_000314.4
PTEN Chr10:89623365 c.-862G>T NM_000314.4 rs587776675
PTEN Chr10:89623373 c.-854C>G NM_000314.4
PTEN Chr10:89623392 c.-835C>T NM_000314.4 rs587779994
PTEN Chr10:89623428 c.-799G>C NM_000314.4 rs587779992
PTEN Chr10:89623462 c.-765G>A NM_000314.4
PTEN Chr10:89690791 c.210-8dupT NM_000314.4
PTEN Chr10:89692749 c.254-21G>C NM_000314.4
PTEN Chr10:89725294 c.*65T>A NM_000314.4
PTEN Chr10:89725304 c.*75_*92delTAATGGCAATAGGACATTinsCTATGGCAATAGGACATTG NM_000314.4
RB1 Chr13:48877814 NM_000321.2 rs576931877
RB1 Chr13:48877836 NM_000321.2
RB1 Chr13:48877837 c.-212G>A NM_000321.2
RB1 Chr13:48877851 c.-198G>A NM_000321.2 rs387906521
RB1 Chr13:48877851 c.-198G>T NM_000321.2
RB1 Chr13:48877852 c.-197G>A NM_000321.2
RB1 Chr13:48877853 NM_000321.2
RB1 Chr13:48877856 NM_000321.2
RB1 Chr13:48877856 NM_000321.2
RB1 Chr13:48877856 c.-193T>A/G NM_000321.2
RB1 Chr13:48877857 c.-192G>A NM_000321.2
RB1 Chr13:48877860 c.-189G>T NM_000321.2 rs387906520
RB1 Chr13:48877899 c.-150G>C NM_000321.2
RB1 Chr13:48877900 c.-149G>T NM_000321.2
RB1 Chr13:48921946 c.501-15T>G NM_000321.2
RB1 Chr13:48930735 c.608-3418A>G NM_000321.2
RB1 Chr13:48937921 c.861+828T>G NM_000321.2
RB1 Chr13:48947691 c.1215+63T>G NM_000321.2
RB1 Chr13:48954175 c.1390-14A>G NM_000321.2 rs9535023
RB1 Chr13:48954239 c.1421+20_1421+33delTAAAAAATTTTTTT NM_000321.2
RB1 Chr13:49027115 c.1696-14C>T NM_000321.2 rs776912915
RB1 Chr13:49027117 c.1696-12T>G NM_000321.2
RB1 Chr13:49030329 c.1815-11A>G NM_000321.2
RB1 Chr13:49039121 c.2212-13T>A NM_000321.2
RB1 Chr13:49039327 c.2326-14T>C NM_000321.2
RB1 Chr13:49046098 c.2490-1398A>G NM_000321.2
RB1 Chr13:49047468 c.2490-28T>C NM_000321.2
RB1 Chr13:49047470 c.2490-26A>C/G/T NM_000321.2
RB1 Chr13:49047470 c.2490-26A>C NM_000321.2
RB1 Chr13:49047470 c.2490-26A>T NM_000321.2
RB1 Chr13:49047470 c.2490-26A>G NM_000321.2
RET Chr10:43572670 c.-37G>C NM_020975.4 rs751005619
RET Chr10:43572680 c.-27C>G NM_020975.4
RET Chr10:43582162 c.73+9385_73+9395delAGCAACTGCCA NM_020975.4 rs368137511
RET Chr10:43606948 c.1522+35C>T NM_020975.4 rs377130948
RET Chr10:43612192 c.2284+13C>T NM_020975.4
RET Chr10:43612198 c.2284+19C>T NM_020975.4
RET Chr10:43613947 c.2392+19T>C NM_020975.4 rs778745375
RPE65 Chr1:68910577 c.246-11A>G NM_000329.2
RYR1 Chr19:38997317 c.8692+131G>A NM_000540.2
RYR2 Chr1:237730106 c.3423+32dupG NM_001035.2
SCN5A Chr3:38639469 c.2024-11T>A NM_198056.2 rs777987317
SCN5A Chr3:38691021 c.-53+1G>A NM_198056.2
SERPINA1 Chr14:94854894 c.-5+2dupT NM_000295.4
SERPINA1 Chr14:94854896 c.-5+1G>A NM_000295.4 rs775786225
SERPINC1 Chr1:173876666 c.1154-14G>A NM_000488.3
SERPINC1 Chr1:173884075 c.42-18C>G NM_000488.3
SERPINC1 Chr1:173886568 c.-171C>G NM_000488.3
SMARCB1 Chr22:24130008 c.93+559A>G NM_003073.3
SMARCB1 Chr22:24176316 c.1119-12C>G NM_003073.3
SMARCB1 Chr22:24176437 c.*70C>T NM_003073.3
SMARCB1 Chr22:24176449 c.*82C>T NM_003073.3
STK11 Chr19:1220520 c.597+16_597+33delGGGGGGCCCTGGGGCGCCinsTG NM_000455.4
STK11 Chr19:1220530 c.598-32_597+31delGCCCCCTCCCGGGC NM_000455.4
TBX20 Chr7:35293780 c.-549G>A NM_001077653.2 rs571512677
TERC Chr3:169482870 n.-22C>T NR_001566.1
TERC Chr3:169482906 NR_001566.1
TERC Chr3:169482948 n.-100C>G NR_001566.1 rs199422256
TERC Chr3:169483086 NR_001566.1 rs199422255
TERT Chr5:1271334 c.2383-15C>T NM_198253.2 rs574645600
TERT Chr5:1295161 c.-57A>C NM_198253.2
TGFB3 Chr14:76425035 c.*495C>T NM_003239.2 rs387906514
TGFB3 Chr14:76447266 c.-30G>A NM_003239.2 rs770828281
TGFBR2 Chr3:30648317 c.-59C>T NM_001024847.2
TMEM127 Chr2:96931137 c.-18C>T NM_017849.3 rs121908813
TP53 Chr17:7571520 NM_000546.5
TP53 Chr17:7577647 c.673-39G>A NM_000546.5
TP53 Chr17:7579601 c.97-11C>G NM_000546.5
TP53 Chr17:7590694 c.-29+1G>T NM_000546.5
TPM1 Chr15:63349172 c.241-12_241-11delCTinsTG NM_001018005.1 rs199476309
TRDN Chr6:123957870 c.22+29A>G NM_006073.3 rs774068079
TSC1 Chr9:135800306 c.363+668G>A NM_000368.4
TSC2 Chr16:2106052 c.600-145C>T NM_000548.3
TSC2 Chr16:2107460 c.848+281C>T NM_000548.3 rs45517132
TSC2 Chr16:2110656 c.976-15G>A NM_000548.3 rs45517150
TSC2 Chr16:2127477 c.2838-122G>A NM_000548.3
TSC2 Chr16:2138031 c.5069-18A>G NM_000548.3 rs45484794
VHL Chr3:10183453 c.-75_-55delCGCACGCAGCTCCGCCCCGCG NM_000551.3 rs727503744
VHL Chr3:10183471 c.-54_-44dupTCCGACCCGCG NM_000551.3
VHL Chr3:10191719 c.*70C>A NM_000551.3
VHL Chr3:10191719 c.*70C>T NM_000551.3 rs552290225

Test Strengths

The strengths of this test include:

  • CAP-accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods, and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Our Nucleus online portal provides transparent and easy access to quality and performance data at the patient level
  • Our publicly available analytic validation demonstrates complete details of test performance
  • ~2,000 non-coding disease-causing variants in our clinical-grade NGS assay for panels (please see ‘Non-coding disease-causing variants covered by this test’)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enables accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

Special reporting policies:

HFE: only homozygous c.845G>A, p.(Cys282Tyr) (NM_000410.4) is reported

MT-RNR1: only the m.1555A>G (NC_012920.1) is reported

TTN: missense and in-frame indel variants are not reported

The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: CHEK2 NM_001005735.2:3, PDGFRA NM_001347828.2:2, PKP2 NM_004572.4:6, PMS2 NM_000535.7:13-15, SDHD NM_001276506.2:4. Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene’s target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:

  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:

  • Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments
  • Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section.

The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.

Our panels are sectioned from our high-quality, clinical grade NGS assay. Please see our sequencing and detection performance table for details regarding our ability to detect different types of alterations (Table).

Assays have been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva and dry blood spots (filter cards). These sample types were selected in order to maximize the likelihood for high-quality DNA yield. The diagnostic yield varies depending on the assay used, referring healthcare professional, hospital and country. Plus analysis increases the likelihood of finding a genetic diagnosis for your patient, as large deletions and duplications cannot be detected using sequence analysis alone. Blueprint Genetics’ Plus Analysis is a combination of both sequencing and deletion/duplication (copy number variant (CNV)) analysis.

The performance metrics listed below are from an initial validation performed at our main laboratory in Finland.

Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Analytical sensitivity to detect single-nucleotide variants and indels were calculated using both versions v3.3.2 and v4.2.1 of high-confidence region benchmark data provided by Genome in a Bottle (GIAB) consortium. Version 4.2.1 is extended to include challenging medically relevant regions and other difficult to map regions. Version 4.2.1 covers 94.1% of reference (GRCh37) and v3.3.2 covers 87.8% of reference. For more information, see GIAB publication https://doi.org/10.1016/j.xgen.2022.100128.

Sensitivity % (TP/(TP+FN) Specificity %
GIAB Version 3.3.2 GIAB Version 4.2.1 GIAB Version 3.3.2 GIAB Version 4.2.1
Single nucleotide variants 99.57 % 97.58 % 100 % 100 %
Insertions, deletions
1-10 bps 95.38 % 95.13 % 100.00 % 100.00 %
11-20 bps 99.09 % 98.15 % 100.00 % 100.00 %
21-50 bps 98.78 % 98.85 % 100.00 % 100.00 %
2-50 bps 97.62 % 97.41 % 100.00 % 100.00 %
Copy number variants (exon level dels/dups, clinical sample performance) Sensitivity Specificity
1 exon level deletion (heterozygous) 100% (14/14) NA
1 exon deletion (homozygous or hemizygous) 100% (5/5) NA
2-4 exon deletion (heterozygous or homozygous) 100% (17/17) NA
5-33 exon deletion (heterozygous) 100% (12/12) NA
1-5 exon duplication (heterozygous or homozygous) 77% (10/13) NA
9-31 exon duplication (heterozygous) 100% (7/7) NA
Simulated CNV detection in reference samples (n=10) Sensitivity
5 exon level deletion/duplication 98 %
Microdeletion/-duplication syndromes (large CNVs, n=22))
Size range (0.1-47 Mb) 100% (22/22)
         
The performance presented above was reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics
Average of median sequencing depths in reference samples 136x
Nucleotides with >20x sequencing coverage (%) 99.77%


Performance of Blueprint Genetics Mitochondrial Sequencing Assay.

ANALYTIC VALIDATION (reference samples; n=4) Sensitivity %      
Single nucleotide variants
Heteroplasmic (45-100%) 100.0% (50/50)
Heteroplasmic (35-45%) 100.0% (87/87)
Heteroplasmic (25-35%) 100.0% (73/73)
Heteroplasmic (15-25%) 100.0% (74/74)
Heteroplasmic (5-15%) 100.0% (79/79)
Heteroplasmic (<5%) 53.3 % (8/15)
CLINICAL VALIDATION (n=20 samples)
Single nucleotide variants (n=18 SNVs) 100.0% (3/3)
Heteroplasmic (10-15%) 100.0% (5/5)
Heteroplasmic (5-10%) 100.0% (5/5)
Heteroplasmic (<5%) 20% (1/5)
Insertions and deletions by sequence analysis (n=3)
Heteroplasmic (45-100%) 1-10bp 100.0% (3/3)
Validation of the mitochondrial genome analysis workflow (based on simulated data of pathogenic mitomap mutations)
Insertions and deletions 1-24 bps by sequence analysis; n=17
Homoplasmic (100%) 1-24bp 100.0% (17/17)
Heteroplasmic (50%) 100.0% (17/17)
Heteroplasmic (25%) 100.0% (17/17)
Heteroplasmic (20%) 100.0% (17/17)
Heteroplasmic (15%) 100.0% (17/17)
Heteroplasmic (10%) 94.1% (16/17)
Heteroplasmic (5%) 94.1% (16/17)
Copy number variants (separate artifical mutations; n=1500)
Homoplasmic (100%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (50%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (30%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (20%) 500 bp, 1kb, 5 kb 99.7%
Heteroplasmic (10%) 500 bp, 1kb, 5 kb 99.0%
Following mtDNA coverage metrics were obtained in clinical samples in the assay validation (n=238)
Mean of medians
Mean sequencing depth MQ0 6334x
Nucleotides with >1000x MQ0 sequencing coverage (%) 100%
rho zero cell line (=no mtDNA), mean sequencing depth in mitochondrial assay validation 12X

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes ProjectgnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as SIFTPolyPhenMutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with <20X sequencing depth if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

We provide customers with the most comprehensive report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists prepare the report by assessing the pathogenicity of the identified variants. Our goal is to provide clinically meaningful reports that are understandable for all medical professionals regardless of whether they have formal training in genetics.  

Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015. Only variants classified as pathogenic or likely pathogenic based on an ACMG/AMP classification scheme will be reported.  

Our screening panel report includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes, and classification of the variant). In addition, the report includes descriptions of the variant and its association with disease. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired.  

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis, or in proactive testing, to confer a risk of developing an inherited disease. In reproductive screening, identification of single pathogenic or likely pathogenic variants in genes related to recessive disorders is considered as a carriership. Disease risk of potential offspring depends on whether both parents have a pathogenic or likely pathogenic variant in the same gene. Reproductive risk related to X-linked disorders may be difficult to estimate due to the possibility of skewed X-chromosome inactivation. Genetic counseling is recommended whenever pathogenic or likely pathogenic variants are reported. 

Reporting focuses on high-quality variants that meet our stringent NGS quality metrics for a true positive call but they are not confirmed with alternative methods. Ordering healthcare professionals should consider further confirmation of the reported variants using a diagnostic test.

Other