Comprehensive Hematology Panel
Offers comprehensive genetic diagnostics for a broad range of hematological disorders varying from bone marrow failure to specific disorders affecting different cell populations or factors involved in hemostasis.
Is not recommended for patients suspected to have anemia due to alpha-thalassemia (HBA1 or HBA2). These genes are highly homologous reducing mutation detection rate due to challenges in variant call and difficult to detect mutation profile (deletions and gene-fusions within the homologous genes tandem in the human genome).
Is not recommended for patients with a suspicion of severe Hemophilia A if the common inversions are not excluded by previous testing. An intron 22 inversion of the F8 gene is identified in 43%-45% individuals with severe hemophilia A and intron 1 inversion in 2%-5% (GeneReviews NBK1404; PMID:8275087, 8490618, 29296726, 27292088, 22282501, 11756167). This test does not detect reliably these inversions. This panel is designed to detect heritable germline mutations and should not be used for the detection of somatic mutations in tumor tissue.
- PLUS
Summary
The Blueprint Genetics Comprehensive Hematology Panel (test code HE0101):
Read about our accreditations, certifications and CE-marked IVD medical devices here.
Sample Requirements
- Blood (min. 1ml) in an EDTA tube
- Extracted DNA, min. 2 μg in TE buffer or equivalent
- Saliva (Please see Sample Requirements for accepted saliva kits)
Label the sample tube with your patient’s name, date of birth and the date of sample collection.
We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.
Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.
Read more about our sample requirements here.
Inherited hematological diseases are a group of blood disorders with variable clinical presentation. Depending on the underlying defect and the affected hematological cell population, the symptoms can vary from bleeding disorders to severe anemia or may cause significant immunosuppression. Furthermore, the inherited defects in coagulopathy may also cause thrombophilia increasing the risk of thrombosis even in childhood. All genetic defects presenting with bone marrow failure lead to severe immunosuppression possibly necessitating stem cell transplantation. Patients with inherited bone marrow failure syndromes have a high risk of developing cancer, either leukemia or solid tumors. The role of genetic diagnostics in inherited hematological diseases is essential. Currently, accurate genetic diagnosis is necessary to confirm the diagnosis of certain hematological diseases and guide their optimal treatment.
Genes in the Comprehensive Hematology Panel and their clinical significance
To view complete table content, scroll horizontally.
| Gene | Associated phenotypes | Inheritance | ClinVar | HGMD |
|---|---|---|---|---|
| ABCA3 | Interstitial lung disease, Surfactant metabolism dysfunction, pulmonary | AR | 11 | 287 |
| ABCB7 | Anemia, sideroblastic, and spinocerebellar ataxia | XL | 8 | 9 |
| ABCG5 | Sitosterolemia | AR | 13 | 42 |
| ABCG8 | Sitosterolemia | AR | 18 | 44 |
| ACD | Dyskeratosis congenita, autosomal dominant 6, Dyskeratosis congenita, autosomal recessive 7 | AD/AR | 2 | 8 |
| ACTB* | Baraitser-Winter syndrome | AD | 55 | 60 |
| ACTN1 | Bleeding disorder, platelet- | AD | 7 | 25 |
| ADAMTS13 | Schulman-Upshaw syndrome, Thrombotic thrombocytopenic purpura, familial | AR | 30 | 183 |
| AK1 | Adenylate kinase deficiency, hemolytic anemia due to | AR | 8 | 10 |
| AK2 | Reticular dysgenesis | AR | 14 | 17 |
| ALAS2 | Anemia, sideroblastic, Protoporphyria, erythropoietic | XL | 27 | 103 |
| AMN | Megaloblastic anemia-1, Norwegian | AR | 29 | 34 |
| ANK1 | Spherocytosis | AD/AR | 20 | 105 |
| ANKRD26 | Thrombocytopenia | AD | 6 | 21 |
| AP3B1 | Hermansky-Pudlak syndrome | AR | 14 | 34 |
| AP3D1 | Hermansky-Pudlak syndrome 10 | AR | 1 | 4 |
| ARPC1B | Platelet abnormalities with eosinophilia and immune-mediated inflammatory disease | AR | 2 | 4 |
| ATM | Breast cancer, Ataxia-Telangiectasia | AD/AR | 1047 | 1109 |
| ATR | Cutaneous telangiectasia and cancer syndrome, Seckel syndrome | AD/AR | 10 | 33 |
| ATRX | Carpenter-Waziri syndrome, Alpha-thalassemia/mental retardation syndrome, Holmes-Gang syndrome, Juberg-Marsidi syndrome, Smith-Fineman-Myers syndrome, Mental retardation-hypotonic facies syndrome | XL | 65 | 165 |
| BLM | Bloom syndrome | AR | 152 | 119 |
| BLOC1S3 | Hermansky-Pudlak syndrome | AR | 2 | 4 |
| BLOC1S6 | Hermansky-Pudlak syndrome | AR | 1 | 2 |
| BRAF* | LEOPARD syndrome, Noonan syndrome, Cardiofaciocutaneous syndrome | AD | 134 | 65 |
| BRCA1* | Pancreatic cancer, Breast-ovarian cancer, familial | AD | 2997 | 2631 |
| BRCA2 | Fanconi anemia, Medulloblastoma, Glioma susceptibility, Pancreatic cancer, Wilms tumor, Breast-ovarian cancer, familial | AD/AR | 3369 | 2659 |
| BRIP1 | Fanconi anemia, Breast cancer | AD/AR | 238 | 189 |
| C15ORF41 | Congenital dyserythropoietic anemia | AR | 3 | 3 |
| C6ORF25 | 1 | 1 | ||
| CBL | Noonan syndrome-like disorder with or without juvenile myelomonocytic leukemia | AD | 24 | 43 |
| CD59 | CD59 deficiency | AR | 4 | 8 |
| CDAN1 | Anemia, dyserythropoietic congenital | AR | 12 | 61 |
| CDC42* | Takenouchi-Kosaki syndrome, Noonan-syndrome like phenotype | AD | 11 | 9 |
| CDKN2A | Melanoma, familial, Melanoma-pancreatic cancer syndrome | AD | 87 | 232 |
| CEBPA | Acute myeloid leukemia, familial | AD | 15 | 13 |
| CECR1 | Polyarteritis nodosa, ADA2 deficiency | AR | 15 | 50 |
| CLCN7 | Osteopetrosis | AD/AR | 15 | 98 |
| CLPB | 3-methylglutaconic aciduria with cataracts, neurologic involvement, and neutropenia (MEGCANN) | AR | 26 | 25 |
| CSF2RA#* | Surfactant metabolism dysfunction, pulmonary | XL | 2 | 17 |
| CSF3R | Neutrophilia, hereditary | AD/AR | 13 | 13 |
| CTC1 | Cerebroretinal microangiopathy with calcifications and cysts | AR | 21 | 33 |
| CTLA4 | Autoimmune lymphoproliferative syndrome, type V | AD | 11 | 34 |
| CTSC | Periodontitis, juvenile, Haim-Munk syndrome, Papillon-Lefevre syndrome | AR | 19 | 92 |
| CUBN* | Megaloblastic anemia-1, Finnish | AR | 42 | 53 |
| CXCR4 | Warts, hypogammaglobulinemia, infections, and myelokathexis (WHIM) syndrome | AD | 5 | 15 |
| CYB5R3 | Methemoglobinemia due to methemoglobin reductase deficiency | AR | 21 | 71 |
| CYCS* | Thrombocytopenia | AD | 2 | 3 |
| DDX41 | Familial myeloproliferative/lymphoproliferative neoplasms, multiple types, susceptibility to | AD | 9 | 21 |
| DHFR* | Megaloblastic anemia due to dihydrofolate reductase deficiency | AR | 2 | 5 |
| DKC1 | Hoyeraal-Hreidarsson syndrome, Dyskeratosis congenita | XL | 48 | 74 |
| DNAJC21 | Bone marrow failure syndrome 3 | AR | 5 | 11 |
| DNASE2 | Primary immunodeficiency | 2 | ||
| DTNBP1 | Hermansky-Pudlak syndrome | AR | 2 | 3 |
| EFL1* | Shwachman-Diamond syndrome | 3 | 2 | |
| EGLN1* | Hemoglobin, high altitude adapation | AD | 3 | 64 |
| ELANE | Neutropenia | AD | 43 | 217 |
| EPAS1 | Erthyrocytosis, familial 4 | AD | 3 | 30 |
| EPB41 | Ellipsocytosis 1 | AR | 6 | 12 |
| EPB42 | Spherocytosis | AR | 8 | 17 |
| EPCAM | Diarrhea 5, with tufting enteropathy, congenital, Colorectal cancer, hereditary nonpolyposis | AD/AR | 38 | 80 |
| EPOR | Erythrocytosis, familial, 1 | AD | 4 | 32 |
| ERCC4 | Fanconi anemia, Xeroderma pigmentosum, XFE progeroid syndrome | AR | 13 | 70 |
| ERCC6L2 | Bone marrow failure syndrome 2 | AR | 4 | 9 |
| ETV6 | Thrombocytopenia 5 | AD | 10 | 38 |
| F10 | Factor X deficiency | AR | 15 | 155 |
| F11 | Factor XI deficiency | AD/AR | 77 | 271 |
| F12 | Angioedema, Factor XII deficiency | AD/AR | 7 | 53 |
| F13A1 | Factor XIIIA deficiency | AR | 20 | 180 |
| F13B | Factor XIIIB deficiency | AR | 4 | 18 |
| F2 | Thrombophilia due to thrombin defect, Prothrombin deficiency, congenital | AD/AR | 14 | 66 |
| F5 | Factor V deficiency, Thrombophilia due to activated protein C resistance | AD/AR | 19 | 157 |
| F7 | Factor VII deficiency | AR | 27 | 322 |
| F8* | Hemophilia A | XL | 296 | 3205 |
| F9 | Hemophilia B, Warfarin sensitivity, Thrombophilia, due to factor IX defect | XL | 117 | 1281 |
| FADD | Infections, recurrent, with encephalopathy, hepatic dysfunction, and cardiovascular malformations | AR | 2 | 1 |
| FANCA | Fanconi anemia | AR | 191 | 677 |
| FANCB | Fanconi anemia | XL | 11 | 21 |
| FANCC | Fanconi anemia | AR | 94 | 64 |
| FANCD2* | Fanconi anemia | AR | 21 | 61 |
| FANCE | Fanconi anemia | AR | 4 | 17 |
| FANCF | Fanconia anemia | AR | 7 | 16 |
| FANCG | Fanconi anemia | AR | 16 | 92 |
| FANCI | Fanconi anemia | AR | 13 | 45 |
| FANCL | Fanconi anemia | AR | 13 | 24 |
| FANCM | Fanconi anemia | AR | 6 | 50 |
| FAS | Autoimmune lymphoproliferative syndrome | AD/AR | 31 | 133 |
| FASLG | Autoimmune lymphoproliferative syndrome, type IB | AD | 2 | 10 |
| FGA | Afibrinogenemia, congenital, Dysfibrinogenemia, congenital, Hypodysfibrinogenemia, congenital, Familial visceral amyloidosis | AD/AR | 10 | 144 |
| FGB | Afibrinogenemia, congenital, Dysfibrinogenemia, congenital, Hypodysfibrinogenemia, congenital | AD/AR | 6 | 92 |
| FGG | Afibrinogenemia, congenital, Hypodysfibrinogenemia, Dysfibrinogenemia, congenital, Hypodysfibrinogenemia, congenital | AD/AR | 7 | 127 |
| FLI1 | Thrombocytopenia, Paris-Trousseau type, Bleeding disorder, platelet type 21 | AD | 7 | 7 |
| FLNA | Frontometaphyseal dysplasia, Osteodysplasty Melnick-Needles, Otopalatodigital syndrome type 1, Otopalatodigital syndrome type 2, Terminal osseous dysplasia with pigmentary defects | XL | 133 | 257 |
| FYB | Thrombocytopenia 3 | AR | 2 | 2 |
| G6PC3 | Neutropenia, severe congenital, Dursun syndrome | AR | 11 | 37 |
| G6PD | Glucose-6-phosphate dehydrogenase deficiency | XL | 45 | 226 |
| GATA1 | Anemia, without thrombocytopenia, Thrombocytopenia with beta-thalessemia,, Dyserythropoietic anemia with thrombocytopenia | XL | 21 | 15 |
| GATA2 | Myelodysplastic syndrome, Chronic neutropenia associated with monocytopenia, evolving to myelodysplasia and acute myeloid leukemia, Acute myeloid leukemia, Emberger syndrome, Immunodeficiency | AD | 30 | 142 |
| GBA* | Gaucher disease | AR | 84 | 488 |
| GCLC | Gamma-glutamylcysteine synthetase deficiency | AR | 2 | 7 |
| GFI1 | Neutropenia, severe congenital, 2 autosomal dominant, Neutropenia, nonimmune chronic idiopathic, of adults | AD | 2 | 6 |
| GFI1B | Bleeding disorder, platelet-type, 17 | AD | 6 | 9 |
| GGCX | Pseudoxanthoma elasticum-like disorder with multiple coagulation factor deficiency, Vitamin K-dependent clotting factors, combined deficiency | AD/AR/Digenic | 13 | 42 |
| GINS1 | Immunodeficiency | AR | 4 | 4 |
| GLRX5 | Spasticity, childhood-onset, with hyperglycinemia | AR | 5 | 6 |
| GP1BA | Pseudo-von Willebrand disease, Bernard-Soulier syndrome | AD/AR | 9 | 73 |
| GP1BB | Giant platelet disorder, isolated, Bernard-Soulier syndrome | AD/AR | 5 | 53 |
| GP9 | Bernard-Soulier syndrome | AR | 6 | 42 |
| GPI | Hemolytic anemia, nonspherocytic due to glucose phosphate isomerase deficiency | AR | 11 | 41 |
| GPR143 | Nystagmus, congenital, Ocular albinism | XL | 22 | 181 |
| GSS | Glutathione synthetase deficiency | AR | 8 | 38 |
| HAVCR2 | ||||
| HAX1 | Neutropenia, severe congenital | AR | 11 | 21 |
| HBA1* | Alpha-thalassemia (Hemoglobin Bart syndrome), Alpha-thalassemia (Hemoglobin H disease) | AR/Digenic | 27 | 214 |
| HBA2#* | Alpha-thalassemia (Hemoglobin Bart syndrome), Alpha-thalassemia (Hemoglobin H disease) | AR/Digenic | 44 | 290 |
| HBB | Sickle cell disease, Thalassemia-beta, dominant inclusion body, Other Thalassemias/Hemoglobinopathies, Beta-thalassemia, Hereditary persistence of fetal hemogoblin | AD/AR/Digenic | 242 | 865 |
| HFE | Hemochromatosis | AR/Digenic | 11 | 56 |
| HK1# | Hemolytic anemia, nonspherocytic, due to hexokinase deficiency, Retinitis pigmentosa 79, Neuropathy, motor and sensory, Russe type (Charcot-Marie-Tooth disease type 4G) | AD/AR | 9 | 7 |
| HMOX1 | Heme oxygenase 1 deficiency | AR | 2 | 5 |
| HOXA11 | Radioulnar synostosis with amegakaryocytic thrombocytopenia | AD | 1 | 1 |
| HPS1* | Hermansky-Pudlak syndrome | AR | 28 | 55 |
| HPS3* | Hermansky-Pudlak syndrome | AR | 10 | 17 |
| HPS4 | Hermansky-Pudlak syndrome | AR | 16 | 22 |
| HPS5 | Hermansky-Pudlak syndrome | AR | 20 | 31 |
| HPS6 | Hermansky-Pudlak syndrome | AR | 13 | 37 |
| HRAS | Costello syndrome, Congenital myopathy with excess of muscle spindles | AD | 43 | 31 |
| IFNGR2 | Immunodeficiency | AR | 4 | 18 |
| IKZF1 | Immunodeficiency, common variable, 13 | AD | 10 | 35 |
| ITGA2 | Fetal and neonatal alloimmune thrombocytopenia | AD/AR | 5 | |
| ITGA2B | Glanzmann thrombasthenia | AD/AR | 22 | 234 |
| ITGB3 | Bleeding disorder, platelet-, Thrombocytopenia, neonatal alloimmune, Glanzmann thrombasthenia | AD/AR | 18 | 165 |
| ITK | Lymphoproliferative syndrome | AR | 4 | 11 |
| JAGN1 | Neutropenia, severe congenital | AR | 8 | 8 |
| JAK2 | Thrombocythemia 3 | AD | 12 | 22 |
| KCNN4 | Dehydrated hereditary stomatocytosis 2 | AD | 3 | 3 |
| KIF23 | Anemia, dyserythropoietic congenital | AD | 1 | 3 |
| KLF1 | Anemia, dyserythropoietic congenital, Blood group, Lutheran inhibitor, Hereditary persistence of fetal hemoglobin | AD/BG | 16 | 45 |
| KRAS* | Noonan syndrome, Cardiofaciocutaneous syndrome | AD | 63 | 35 |
| LAMTOR2 | Immunodeficiency due to defect in MAPBP-interacting protein | AR | 1 | 1 |
| LMAN1 | Combined factor V and VIII deficiency | AR | 5 | 37 |
| LPIN2 | Majeed syndrome | AR | 12 | 14 |
| LYST* | Chediak-Higashi syndrome | AR | 50 | 97 |
| MAGT1 | Immunodeficiency, with magnesium defect, Epstein-Barr virus infection and neoplasia, Mental retardation, X-linked 95 | XL | 8 | 14 |
| MAP2K1 | Cardiofaciocutaneous syndrome | AD | 45 | 23 |
| MAP2K2 | Cardiofaciocutaneous syndrome | AD | 21 | 35 |
| MASTL | Thrombocytopenia | AD | 5 | |
| MCFD2 | Factor V & Factor VIII, combined deficiency of | AR | 8 | 20 |
| MECOM | Radioulnar synostosis with amegakaryocytic thrombocytopenia 2 | AD | 3 | 27 |
| MKL1 | Primary immunodeficiency | AR | 4 | |
| MLH1 | Muir-Torre syndrome, Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis | AD/AR | 873 | 1191 |
| MPL | Thrombocythemia, Amegakaryocytic thrombocytopenia | AD/AR | 23 | 55 |
| MSH2 | Muir-Torre syndrome, Endometrial cancer, Colorectal cancer, hereditary nonpolyposis,, Mismatch repair cancer syndrome | AD/AR | 933 | 1249 |
| MSH6 | Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis | AD/AR | 672 | 586 |
| MTHFD1 | Severe combined immunodeficiency | AR | 9 | 11 |
| MTR | Methylmalonic acidemia | AR | 13 | 43 |
| MYH9 | Sebastian syndrome, May-Hegglin anomaly, Epstein syndrome, Fechtner syndrome, Macrothrombocytopenia and progressive sensorineural deafness, Deafness, autosomal dominant 17 | AD | 25 | 117 |
| MYO5A | Griscelli syndrome | AR | 7 | 9 |
| NAF1 | AD | 2 | ||
| NBEAL2 | Gray platelet syndrome | AR | 10 | 51 |
| NBN | Breast cancer, Nijmegen breakage syndrome, demonstrating report layout issue with very long condition descriptions | AD/AR | 188 | 97 |
| NF1* | Watson syndrome, Neurofibromatosis, Neurofibromatosis-Noonan syndrome | AD | 1157 | 2901 |
| NHP2 | Dyskeratosis congenita | AR | 5 | 3 |
| NOP10 | Dyskeratosis congenita | AR | 1 | 1 |
| NRAS | Noonan syndrome | AD | 31 | 14 |
| NT5C3A | Uridine 5-prime monophosphate hydrolase deficiency, hemolytic anemia due to | AR | 10 | 28 |
| OBFC1 | 2 | 2 | ||
| OCA2 | Albinism, brown oculocutaneous, Albinism, oculocutaneous, Skin/hair/eye pigmentation | AR | 43 | 310 |
| P2RY12 | Bleeding disorder, platelet- | AD/AR | 4 | 13 |
| PALB2 | Fanconi anemia, Pancreatic cancer, Breast cancer | AD/AR | 495 | 406 |
| PARN* | Pulmonary fibrosis and/or bone marrow failure, Dyskeratosis congenita | AD/AR | 15 | 29 |
| PAX5 | Pre-B cell acute lymphoblastic leukemia | AD | 7 | |
| PC | Pyruvate carboxylase deficiency | AR | 32 | 41 |
| PDHA1 | Leigh syndrome, Pyruvate dehydrogenase E1-alpha deficiency | XL | 66 | 192 |
| PDHX | Pyruvate dehydrogenase E3-binding protein deficiency | AR | 14 | 22 |
| PGK1 | Phosphoglycerate kinase 1 deficiency | XL | 16 | 26 |
| PGM3# | Immunodeficiency 23 | AR | 14 | 15 |
| PIEZO1 | Dehydrated hereditary stomatocytosis, Lympehedema, hereditary III | AD/AR | 23 | 60 |
| PKLR | Pyruvate kinase deficiency, Elevation of red blood cell ATP levels, familial | AD/AR | 17 | 277 |
| PMS2#* | Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis | AD/AR | 319 | 342 |
| POT1 | Glioma susceptibility 9, Melanoma, cutaneous malignant, susceptibility to 10 | AD | 2 | 34 |
| PRF1 | Lymphoma, non-Hodgkin, Aplastic anemia, adult-onset, Hemophagocytic lymphohistiocytosis | AR | 24 | 183 |
| PRKACG | Bleeding disorder, platelet-type, 19 | AR | 1 | 1 |
| PROC | Thrombophilia, hereditary | AD/AR | 36 | 387 |
| PROS1* | Thrombophilia, hereditary | AD/AR | 23 | 416 |
| PTPN11 | Noonan syndrome, Metachondromatosis | AD | 135 | 140 |
| PUS1 | Mitochondrial myopathy and sideroblastic anemia | AR | 7 | 9 |
| RAB27A | Griscelli syndrome, Elejalde syndrome | AR | 18 | 54 |
| RAC2 | Neutrophil immunodeficiency syndrome | AD | 2 | 3 |
| RAD51C | Fanconi anemia, Breast-ovarian cancer, familial | AD/AR | 107 | 125 |
| RASGRP2 | Bleeding disorder, platelet-type, 18 | AR | 3 | 20 |
| RBM8A* | Thrombocytopenia - absent radius | AD/AR | 5 | 12 |
| RECQL4 | Baller-Gerold syndrome, RAPADILINO syndrome, Rothmund-Thomson syndrome | AR | 82 | 114 |
| REN | Hyperuricemic nephropathy, Hyperproreninemia, familial, Renal tubular dysgenesis | AD/AR | 9 | 18 |
| RHAG | Overhydrated hereditary stomatocytosis, Anemia, hemolytic, Rh-null, regulator type, Anemia, hemolytic,Rh-Mod type, RHAG blood group | AD/AR/BG | 13 | 28 |
| RIT1 | Noonan syndrome | AD | 23 | 26 |
| RNF168 | RIDDLE syndrome | AR | 4 | 5 |
| RPL11 | Diamond-Blackfan anemia | AD | 12 | 45 |
| RPL15#* | Diamond-Blackfan anemia | AD | 2 | 2 |
| RPL26 | Diamond-Blackfan anemia 11 | AD | 2 | 1 |
| RPL27 | Diamond-Blackfan anemia 16 | 1 | 1 | |
| RPL31 | Diamond-Blackfan anemia | AD | 2 | |
| RPL35A | Diamond-Blackfan anemia | AD | 7 | 14 |
| RPL5 | Diamond-Blackfan anemia | AD | 19 | 77 |
| RPS10 | Diamond-Blackfan anemia | AD | 3 | 5 |
| RPS19 | Diamond-Blackfan anemia | AD | 23 | 172 |
| RPS24 | Diamond-Blackfan anemia | AD | 6 | 10 |
| RPS26 | Diamond-Blackfan anemia | AD | 10 | 33 |
| RPS28 | Diamond-Blackfan anemia 15 with mandibulofacial dysostosis | AD | 1 | 1 |
| RPS29 | Diamond-Blackfan anemia | AD | 4 | 4 |
| RPS7 | Diamond-Blackfan anemia | AD | 2 | 10 |
| RTEL1 | Pulmonary fibrosis and/or bone marrow failure, Dyskeratosis congenita | AD/AR | 58 | 51 |
| RUNX1 | Platelet disorder, familial, with associated myeloid malignancy | AD | 47 | 101 |
| SAMD9 | Mirage syndrome, Tumoral calcinosis, normophosphatemic | AD/AR | 10 | 27 |
| SAMD9L | Ataxia-pancytopenia syndrome | AD | 4 | 16 |
| SBDS* | Aplastic anemia, Shwachman-Diamond syndrome, Severe spondylometaphyseal dysplasia | AR | 19 | 90 |
| SEC23B | Anemia, dyserythropoietic congenital | AR | 18 | 121 |
| SERPINC1 | Antithrombin III deficiency | AD/AR | 44 | 412 |
| SERPINF2 | Alpha-2-plasmin inhibitor deficiency | AD/AR | 4 | 8 |
| SFTPB | Surfactant metabolism dysfunction, pulmonary | AR | 5 | 28 |
| SFTPC | Surfactant metabolism dysfunction, pulmonary | AD | 8 | 82 |
| SH2D1A | Lymphoproliferative syndrome | XL | 21 | 129 |
| SLC11A2 | Anemia, hypochromic microcytic, with iron overload | AR | 5 | 10 |
| SLC19A2 | Thiamine-responsive megaloblastic anemia syndrome | AR | 14 | 51 |
| SLC25A38 | Anemia, sideroblastic 2, pyridoxine-refractory | AR | 7 | 27 |
| SLC37A4 | Glycogen storage disease | AR | 49 | 113 |
| SLC45A2 | Skin/hair/eye pigmentation, Oculocutaneous albinism | AD/AR | 16 | 156 |
| SLC46A1 | Folate malabsorption | AR | 17 | 23 |
| SLC4A1 | Spherocytosis, Ovalcytosis, Renal tubular acidosis, distal, with hemolytic anemia, Cryohydrocytosis, Acanthocytosis, Band 3 Memphis | AD/AR/BG | 38 | 122 |
| SLFN14 | Thrombocytopenia | AD/AR | 4 | 4 |
| SLX4 | Fanconi anemia | AR | 18 | 72 |
| SMARCD2 | Specific granule defiency 2 | AR | 3 | 1 |
| SOS1 | Noonan syndrome | AD | 44 | 71 |
| SPTA1 | Spherocytosis, Ellipsocytosis, Pyropoikilocytosis | AD/AR | 29 | 51 |
| SPTB | Spherocytosis, Anemia, neonatal hemolytic, Ellipsocytosis | AD/AR | 24 | 99 |
| SRC | Thrombocytopenia, autosomal dominant, 6 | AD | 2 | 1 |
| SRP54 | Shwachman-Diamond syndrome | AD | 3 | |
| SRP72* | Bone marrow failure syndrome 1 | AD | 2 | 5 |
| STAT3 | Hyper-IgE recurrent infection syndrome, Autoimmune disease, multisystem, infantile onset | AD | 47 | 152 |
| STX11 | Hemophagocytic lymphohistiocytosis, familial | AR | 8 | 22 |
| STXBP2 | Hemophagocytic lymphohistiocytosis, familial | AR | 12 | 77 |
| TBXA2R | Bleeding disorder, platelet- | AD | 1 | 6 |
| TBXAS1 | Ghosal hematodiaphyseal syndrome | AR | 7 | 6 |
| TCN2 | Transcobalamin II deficiency | AR | 9 | 35 |
| TERC | Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita | AD | 42 | 73 |
| TERT | Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita | AD/AR | 48 | 156 |
| TF | Atransferrinemia | AR | 8 | 17 |
| THBD | Thrombophilia due to thrombomodulin defect, Hemolytic uremic syndrome, atypical | AD | 5 | 28 |
| THPO | Thrombocythemia 1 | AD | 5 | 10 |
| TINF2 | Revesz syndrome, Dyskeratosis congenita | AD | 25 | 42 |
| TMPRSS6 | Iron-refractory iron deficiency anemia | AR | 13 | 102 |
| TP53 | Colorectal cancer, Li-Fraumeni syndrome, Ependymoma, intracranial, Choroid plexus papilloma, Breast cancer, familial, Adrenocortical carcinoma, Osteogenic sarcoma, Hepatoblastoma, Non-Hodgkin lymphoma | AD | 393 | 505 |
| TPI1 | Triosephosphate isomerase deficiency | AR | 8 | 19 |
| TRNT1 | Retinitis pigmentosa and erythrocytic microcytosis, Sideroblastic anemia with B-cell immunodeficiency, periodic fevers, and developmental delay | AR | 13 | 26 |
| TUBB1 | Macrothrombocytopenia | AD | 2 | 7 |
| TYR* | Albinism, oculocutaneous | AR | 77 | 441 |
| TYRP1 | Albinism, oculocutaneous | AR | 10 | 55 |
| UBE2T | Fanconi anemia, complementation group T | AR | 2 | 7 |
| UNC13D | Hemophagocytic lymphohistiocytosis, familial | AR | 22 | 192 |
| USB1 | Poikiloderma with neutropenia | AR | 24 | 22 |
| VKORC1# | Drug metabolism, VKORC1-related, Vitamin K-dependent clotting factors, combined deficiency | AD/AR | 4 | 27 |
| VPS13B | Cohen syndrome | AR | 351 | 203 |
| VPS45# | Neutropenia, severe congenital, 5, autosomal recessive | AR | 3 | 4 |
| VWF* | Von Willebrand disease | AD/AR | 57 | 1009 |
| WAS | Neutropenia, severe congenital, Thrombocytopenia, Wiskott-Aldrich syndrome | XL | 57 | 439 |
| WDR1 | AR | 8 | ||
| WIPF1 | Wiskott-Aldrich syndrome 2 | AR | 2 | 3 |
| WRAP53 | Dyskeratosis congenita | AR | 7 | 6 |
| XIAP* | Lymphoproliferative syndrome | XL | 14 | 96 |
| XRCC2 | Hereditary breast cancer | AD/AR | 10 | 21 |
| YARS2 | Myopathy, lactic acidosis, and sideroblastic anemia | AR | 27 | 11 |
| ZCCHC8 | 1 |
The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.
Some, or all, of the gene is duplicated in the genome. Read more.
The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.
Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.
Non-coding variants covered by Comprehensive Hematology Panel
To view complete table content, scroll horizontally.
| Gene | Genomic location HG19 | HGVS | RefSeq | RS-number |
|---|---|---|---|---|
| ABCA3 | Chr16:2333457 | c.3863-98C>T | NM_001089.2 | rs189077405 |
| ABCA3 | Chr16:2358644 | c.1112-20G>A | NM_001089.2 | rs746701685 |
| ABCA3 | Chr16:2376495 | c.-26-2A>G | NM_001089.2 | |
| ALAS2 | ChrX:55054634 | c.-15-2186C>G | NM_000032.4 | |
| ALAS2 | ChrX:55054635 | c.-15-2187T>C | NM_000032.4 | |
| ALAS2 | ChrX:55054636 | c.-15-2188A>G | NM_000032.4 | |
| ALAS2 | ChrX:55057393 | c.-34C>T | NM_000032.4 | rs780642606 |
| ALAS2 | ChrX:55057617 | c.-258C>G | NM_000032.4 | rs140772352 |
| AMN | Chr14:103395424 | c.514-34G>A | NM_030943.3 | rs144077391 |
| AMN | Chr14:103396444 | c.1007-31_1006+34delCCTCGCCCCGCCGCG | NM_030943.3 | rs386834161 |
| AMN | Chr14:103396458 | c.1007-29_1006+36delTCGCCCCGCCGCGGG | NM_030943.3 | rs386834162 |
| ANK1 | Chr8:41566510 | c.1900-17G>A | NM_001142446.1 | rs786205243 |
| ANK1 | Chr8:41566511 | c.1900-18C>A | NM_001142446.1 | |
| ANK1 | Chr8:41655127 | c.-73_-72delTG | NM_020476.2 | rs786205242 |
| ANKRD26 | Chr10:27389371 | c.-116C>G | NM_014915.2 | |
| ANKRD26 | Chr10:27389373 | c.-118C>A | NM_014915.2 | |
| ANKRD26 | Chr10:27389374 | c.-119C>A/G | NM_014915.2 | |
| ANKRD26 | Chr10:27389374 | c.-119C>A | NM_014915.2 | |
| ANKRD26 | Chr10:27389376 | c.-121A>C | NM_014915.2 | |
| ANKRD26 | Chr10:27389380 | c.-127_-126delAT | NM_014915.2 | |
| ANKRD26 | Chr10:27389381 | c.-126T>C | NM_014915.2 | |
| ANKRD26 | Chr10:27389381 | c.-126T>G | NM_014915.2 | |
| ANKRD26 | Chr10:27389382 | c.-127A>G | NM_014915.2 | |
| ANKRD26 | Chr10:27389382 | c.-127A>T | NM_014915.2 | |
| ANKRD26 | Chr10:27389383 | c.-128G>T | NM_014915.2 | |
| ANKRD26 | Chr10:27389383 | c.-128G>A | NM_014915.2 | |
| ANKRD26 | Chr10:27389383 | c.-128G>C | NM_014915.2 | |
| ANKRD26 | Chr10:27389389 | c.-134G>A | NM_014915.2 | rs863223318 |
| ATM | Chr11:108093770 | c.-174A>G | NM_000051.3 | |
| ATM | Chr11:108094508 | c.-31+595G>A | NM_000051.3 | |
| ATM | Chr11:108098321 | c.-30-1G>T | NM_000051.3 | rs869312754 |
| ATM | Chr11:108138753 | c.2639-384A>G | NM_000051.3 | |
| ATM | Chr11:108141209 | c.2839-579_2839-576delAAGT | NM_000051.3 | |
| ATM | Chr11:108151710 | c.3403-12T>A | NM_000051.3 | rs201370733 |
| ATM | Chr11:108158168 | c.3994-159A>G | NM_000051.3 | rs864622543 |
| ATM | Chr11:108164028 | c.4612-12A>G | NM_000051.3 | |
| ATM | Chr11:108179837 | c.5763-1050A>G | NM_000051.3 | rs774925473 |
| ATM | Chr11:108214779 | c.8418+681A>G | NM_000051.3 | rs748635985 |
| BRCA1 | Chr17:41196352 | c.*1340_*1342delTGT | NM_007294.3 | rs1281551853 |
| BRCA1 | Chr17:41196424 | c.*1271T>C | NM_007294.3 | |
| BRCA1 | Chr17:41197167 | c.*528G>C | NM_007294.3 | rs1060504556 |
| BRCA1 | Chr17:41197588 | c.*103_*106delTGTC | NM_007294.3 | rs431825382 |
| BRCA1 | Chr17:41197637 | c.*58C>T | NM_007294.3 | rs137892861 |
| BRCA1 | Chr17:41197859 | c.5468-40T>A | NM_007294.3 | rs80358151 |
| BRCA1 | Chr17:41199745 | c.5407-25T>A | NM_007294.3 | rs758780152 |
| BRCA1 | Chr17:41201232 | c.5333-36_5333-22delTACTGCAGTGATTTT | NM_007294.3 | |
| BRCA1 | Chr17:41206122 | c.5277+2916_5277+2946delAAATTCTAGTGCTTTGGATTTTTTCCTCCATinsGG | NM_007294.3 | |
| BRCA1 | Chr17:41209164 | c.5194-12G>A | NM_007294.3 | rs80358079 |
| BRCA1 | Chr17:41215994 | c.5075-27delA | NM_007294.3 | |
| BRCA1 | Chr17:41251909 | c.442-22_442-13delTGTTCTTTAC | NM_007294.3 | rs879254224 |
| BRCA1 | Chr17:41256984 | c.213-11T>G | NM_007294.3 | rs80358061 |
| BRCA1 | Chr17:41256985 | c.213-12A>G | NM_007294.3 | rs80358163 |
| BRCA1 | Chr17:41256988 | c.213-15A>G | NM_007294.3 | |
| BRCA1 | Chr17:41276134 | c.-19-2A>G | NM_007294.3 | |
| BRCA2 | Chr13:32889805 | c.-40+1G>A | NM_000059.3 | |
| BRCA2 | Chr13:32890469 | c.-39-89delC | NM_000059.3 | |
| BRCA2 | Chr13:32890556 | c.-39-1_-39delGA | NM_000059.3 | rs758732038 |
| BRCA2 | Chr13:32890558 | c.-39-1G>A | NM_000059.3 | rs1060499566 |
| BRCA2 | Chr13:32900222 | c.426-12_426-8delGTTTT | NM_000059.3 | rs276174844 |
| BRCA2 | Chr13:32945079 | c.8488-14A>G | NM_000059.3 | |
| BRCA2 | Chr13:32953872 | c.8954-15T>G | NM_000059.3 | |
| BRCA2 | Chr13:32971007 | c.9502-28A>G | NM_000059.3 | rs397508059 |
| BRCA2 | Chr13:32971023 | c.9502-12T>G | NM_000059.3 | rs81002803 |
| BRIP1 | Chr17:59858864 | c.1629-498A>T | NM_032043.2 | |
| CDKN2A | Chr9:21968346 | c.458-105A>G | NM_000077.4 | |
| CDKN2A | Chr9:21973573 | c.150+1104C>A | NM_000077.4 | rs756102261 |
| CDKN2A | Chr9:21974401 | c.*73+2T>G | NM_058197.4 | |
| CDKN2A | Chr9:21974847 | c.-21C>T | NM_000077.4 | |
| CDKN2A | Chr9:21974875 | c.-49C>A | NM_000077.4 | rs1064797383 |
| CDKN2A | Chr9:21974882 | c.-56G>T | NM_000077.4 | |
| CDKN2A | Chr9:21974916 | c.-93_-91delAGG | NM_000077.4 | |
| CECR1 | Chr22:17664763 | c.1082-1113delA | NM_017424.2 | |
| CLCN7 | Chr16:1506057 | c.916+57A>T | NM_001287.5 | |
| CLCN7 | Chr16:1507356 | c.739-18G>A | NM_001287.5 | rs371893553 |
| CTSC | Chr11:88070895 | c.-55C>A | NM_001814.4 | rs766114323 |
| CUBN | Chr10:17088532 | c.3330-439C>G | NM_001081.3 | rs386833782 |
| DKC1 | ChrX:153991099 | c.-142C>G | NM_001363.3 | rs199422241 |
| DKC1 | ChrX:153991100 | c.-141C>G | NM_001363.3 | |
| DKC1 | ChrX:153993704 | c.85-15T>C | NM_001363.3 | |
| EPCAM | Chr2:47606078 | c.556-14A>G | NM_002354.2 | rs376155665 |
| F11 | Chr4:187186995 | c.-456G>A | NM_000128.3 | |
| F11 | Chr4:187197061 | c.595+11A>G | NM_000128.3 | rs534170853 |
| F11 | Chr4:187205426 | c.1304+12G>A | NM_000128.3 | rs116667976 |
| F12 | Chr5:176836590 | NM_000505.3 | rs187018744 | |
| F13A1 | Chr6:6320800 | c.-19_-19+19delGGTAAGCCACCGACCCTGCA | NM_000129.3 | |
| F2 | Chr11:46742048 | c.241-25C>G | NM_000506.3 | |
| F2 | Chr11:46761055 | c.*97G>A | NM_000506.4 | rs1799963 |
| F2 | Chr11:46761064 | c.*106T>A | NM_000506.3 | |
| F2 | Chr11:46761066 | c.*108C>T | NM_000506.3 | rs562369397 |
| F5 | Chr1:169494158 | c.5717-12T>A | NM_000130.4 | |
| F5 | Chr1:169521527 | c.1296+268A>G | NM_000130.4 | |
| F5 | Chr1:169521984 | c.1119-12C>G | NM_000130.4 | |
| F7 | Chr13:113760060 | c.-96C>T | NM_000131.4 | |
| F7 | Chr13:113760062 | c.-94C>G | NM_000131.4 | |
| F7 | Chr13:113760091 | c.-65G>C | NM_000131.4 | |
| F7 | Chr13:113760094 | c.-62C>T | NM_000131.4 | |
| F7 | Chr13:113760094 | NM_000131.4 | ||
| F7 | Chr13:113760095 | c.-61T>G | NM_000131.4 | |
| F7 | Chr13:113760096 | NM_000131.4 | ||
| F7 | Chr13:113760096 | NM_000131.4 | ||
| F7 | Chr13:113760097 | c.-59T>G | NM_000131.4 | |
| F7 | Chr13:113760099 | c.-57C>T | NM_000131.4 | |
| F7 | Chr13:113760101 | NM_000131.4 | ||
| F7 | Chr13:113760101 | NM_000131.4 | ||
| F7 | Chr13:113760112 | c.-44T>C | NM_000131.4 | rs577393666 |
| F7 | Chr13:113760117 | c.-39A>G | NM_000131.4 | |
| F7 | Chr13:113760124 | c.-32A>C | NM_000131.4 | rs761212787 |
| F7 | Chr13:113760126 | c.-30A>C | NM_000131.4 | rs539578931 |
| F7 | Chr13:113764993 | c.131-11G>A | NM_000131.4 | |
| F7 | Chr13:113766228 | c.291+1065delC | NM_000131.4 | |
| F7 | Chr13:113770192 | c.571+78G>A | NM_000131.4 | rs764741909 |
| F7 | Chr13:113771068 | c.572-12T>A | NM_000131.4 | |
| F8 | ChrX:154091516 | c.6430-14A>G | NM_000132.3 | |
| F8 | ChrX:154130453 | c.5999-11G>A | NM_000132.3 | rs782132907 |
| F8 | ChrX:154130463 | c.5999-23_5999-22delCT | NM_000132.3 | |
| F8 | ChrX:154130464 | c.5999-33_5999-22delGAAATAATTTCTinsATTC | NM_000132.3 | |
| F8 | ChrX:154130469 | c.5999-33_5999-28delGAAATA | NM_000132.3 | |
| F8 | ChrX:154130719 | c.5999-277G>A | NM_000132.3 | |
| F8 | ChrX:154131240 | c.5999-798G>A | NM_000132.3 | |
| F8 | ChrX:154132376 | c.5816-14_5816-13delGTinsTA | NM_000132.3 | |
| F8 | ChrX:154132397 | c.5816-34A>T | NM_000132.3 | rs782301004 |
| F8 | ChrX:154132892 | c.5587-93C>T | NM_000132.3 | |
| F8 | ChrX:154134863 | c.5220-16_5220-15insA | NM_000132.3 | |
| F8 | ChrX:154175961 | c.2113+12T>A | NM_000132.3 | |
| F8 | ChrX:154176219 | c.1904-37G>A | NM_000132.3 | rs367615232 |
| F8 | ChrX:154185464 | c.1538-18G>A | NM_000132.3 | |
| F8 | ChrX:154189025 | c.1537+325A>G | NM_000132.3 | |
| F8 | ChrX:154189458 | c.1444-15C>A | NM_000132.3 | |
| F8 | ChrX:154197841 | c.788-14T>G | NM_000132.3 | |
| F8 | ChrX:154213089 | c.671-11T>C | NM_000132.3 | |
| F8 | ChrX:154215591 | c.602-11T>G | NM_000132.3 | |
| F8 | ChrX:154215612 | c.602-32A>G | NM_000132.3 | |
| F8 | ChrX:154219579 | c.601+1632G>A | NM_000132.3 | rs387906429 |
| F8 | ChrX:154221439 | c.389-16T>G | NM_000132.3 | |
| F8 | ChrX:154227886 | c.144-11T>G | NM_000132.3 | |
| F8 | ChrX:154227901 | c.144-26A>T | NM_000132.3 | |
| F8 | ChrX:154238632 | c.144-10758_144-10757insTATA | NM_000132.3 | |
| F8 | ChrX:154249118 | c.143+1567A>G | NM_000132.3 | |
| F8 | ChrX:154250939 | c.-112G>A | NM_000132.3 | rs1317271565 |
| F8 | ChrX:154251045 | NM_000132.3 | ||
| F8 | ChrX:154251045 | c.-218T>C | NM_000132.3 | |
| F8 | ChrX:154251046 | c.-219C>T | NM_000132.3 | |
| F8 | ChrX:154251048 | c.-221T>A | NM_000132.3 | |
| F8 | ChrX:154251082 | c.-255A>G | NM_000132.3 | |
| F8 | ChrX:154251084 | NM_000132.3 | ||
| F8 | ChrX:154251084 | NM_000132.3 | ||
| F8 | ChrX:154251084 | c.-257T>C/G | NM_000132.3 | |
| F8 | ChrX:154251687 | c.-860A>G | NM_000132.3 | |
| F8 | ChrX:154251793 | c.-966G>T | NM_000132.3 | |
| F9 | ChrX:138612869 | NM_000133.3 | ||
| F9 | ChrX:138612869 | NM_000133.3 | ||
| F9 | ChrX:138612869 | NM_000133.3 | ||
| F9 | ChrX:138612869 | c.-55G>A/C/T | NM_000133.3 | |
| F9 | ChrX:138612871 | c.-53A>G | NM_000133.3 | |
| F9 | ChrX:138612871 | NM_000133.3 | ||
| F9 | ChrX:138612872 | NM_000133.3 | ||
| F9 | ChrX:138612872 | NM_000133.3 | ||
| F9 | ChrX:138612872 | c.-52C>G/T | NM_000133.3 | |
| F9 | ChrX:138612874 | c.-50T>C/G | NM_000133.3 | |
| F9 | ChrX:138612874 | NM_000133.3 | ||
| F9 | ChrX:138612874 | NM_000133.3 | ||
| F9 | ChrX:138612875 | NM_000133.3 | ||
| F9 | ChrX:138612875 | NM_000133.3 | rs1178811105 | |
| F9 | ChrX:138612875 | c.-49T>A/C | NM_000133.3 | |
| F9 | ChrX:138612876 | c.-48G>C | NM_000133.3 | |
| F9 | ChrX:138612886 | c.-38A>G | NM_000133.3 | |
| F9 | ChrX:138612889 | NM_000133.3 | rs1166164399 | |
| F9 | ChrX:138612889 | NM_000133.3 | ||
| F9 | ChrX:138612889 | c.-35G>A/C | NM_000133.3 | |
| F9 | ChrX:138612890 | c.-34A>G/T | NM_000133.3 | |
| F9 | ChrX:138612890 | NM_000133.3 | ||
| F9 | ChrX:138612890 | NM_000133.3 | ||
| F9 | ChrX:138612899 | c.-22delT | NM_000133.3 | |
| F9 | ChrX:138612900 | c.-24T>A | NM_000133.3 | |
| F9 | ChrX:138612901 | c.-23T>C | NM_000133.3 | |
| F9 | ChrX:138612902 | c.-22T>C | NM_000133.3 | |
| F9 | ChrX:138612903 | c.-21C>G | NM_000133.3 | |
| F9 | ChrX:138612905 | c.-19C>G | NM_000133.3 | |
| F9 | ChrX:138612905 | c.-17delA | NM_000133.3 | |
| F9 | ChrX:138612906 | c.-18A>T | NM_000133.3 | |
| F9 | ChrX:138612906 | c.-18A>G | NM_000133.3 | |
| F9 | ChrX:138612906 | c.-18A>G/T | NM_000133.3 | |
| F9 | ChrX:138612907 | c.-17A>C/G | NM_000133.3 | |
| F9 | ChrX:138612907 | c.-17A>C | NM_000133.3 | |
| F9 | ChrX:138612907 | c.-17A>G | NM_000133.3 | |
| F9 | ChrX:138619496 | c.253-25A>T | NM_000133.3 | |
| F9 | ChrX:138619496 | c.253-25A>G | NM_000133.3 | rs1201753038 |
| F9 | ChrX:138619496 | c.253-25A>G/T | NM_000133.3 | |
| F9 | ChrX:138619501 | c.253-19_253-16delCTTC | NM_000133.3 | |
| F9 | ChrX:138619502 | c.253-16_253-12delCTTTT | NM_000133.3 | |
| F9 | ChrX:138623222 | c.278-13A>G | NM_000133.3 | |
| F9 | ChrX:138623223 | c.278-12C>G | NM_000133.3 | |
| F9 | ChrX:138623223 | c.278-12C>T | NM_000133.3 | rs1475223858 |
| F9 | ChrX:138623223 | c.278-12C>G/T | NM_000133.3 | |
| F9 | ChrX:138630499 | c.392-22_392-21delCT | NM_000133.3 | |
| F9 | ChrX:138630663 | c.520+13A>G | NM_000133.3 | |
| F9 | ChrX:138633441 | c.723+18T>A | NM_000133.3 | |
| F9 | ChrX:138645387 | c.*1157A>G | NM_000133.3 | |
| F9 | ChrX:138645598 | c.*1368A>G | NM_000133.3 | |
| FANCA | Chr16:89805127 | c.4261-19_4261-12delACCTGCTC | NM_000135.3 | |
| FANCA | Chr16:89816056 | c.3239+82T>G | NM_000135.2 | |
| FANCA | Chr16:89818822 | c.2982-192A>G | NM_000135.2 | |
| FANCA | Chr16:89831215 | c.2778+83C>G | NM_000135.2 | rs750997715 |
| FANCA | Chr16:89836111 | c.2504+134A>G | NM_000135.2 | |
| FANCA | Chr16:89836805 | c.2223-138A>G | NM_000135.2 | |
| FANCA | Chr16:89849346 | c.1567-20A>G | NM_000135.2 | rs775154397 |
| FANCC | Chr9:98011653 | c.-78-2A>G | NM_000136.2 | rs587779898 |
| FANCC | Chr9:98079807 | c.-79+1G>A | NM_000136.2 | |
| FANCD2 | Chr3:10083186 | c.696-121C>G | NM_033084.3 | |
| FANCD2 | Chr3:10102127 | c.1766+40T>G | NM_033084.3 | |
| FANCD2 | Chr3:10106024 | c.1948-16T>G | NM_033084.3 | |
| FANCI | Chr15:89825208 | c.1583+142C>T | NM_001113378.1 | |
| FANCL | Chr2:58433394 | c.375-2033C>G | NM_001114636.1 | |
| FAS | Chr10:90770494 | c.506-16A>G | NM_000043.4 | |
| FASLG | Chr1:172628081 | c.-261T>C | NM_000639.1 | |
| FGB | Chr4:155486360 | c.115-600A>G | NM_005141.4 | |
| FGB | Chr4:155490472 | c.958+13C>T | NM_005141.4 | rs606231223 |
| FGG | Chr4:155527225 | c.1129+632A>G | NM_021870.2 | rs2066862 |
| FGG | Chr4:155527787 | c.1129+66_1129+69delAATA | NM_021870.2 | rs139788771 |
| FGG | Chr4:155530122 | c.667-320A>T | NM_021870.2 | |
| FLNA | ChrX:153581587 | c.6023-27_6023-16delTGACTGACAGCC | NM_001110556.1 | |
| GATA1 | ChrX:48649496 | c.-19-2A>G | NM_002049.3 | |
| GATA2 | Chr3:128202131 | c.1017+572C>T | NM_032638.4 | |
| GATA2 | Chr3:128202162 | c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC | NM_032638.4 | |
| GATA2 | Chr3:128202171 | c.1017+532T>A | NM_032638.4 | |
| GBA | Chr1:155205646 | c.1225-14_1225-11delTGTCinsAGT | NM_000157.3 | |
| GBA | Chr1:155208109 | c.589-12C>G | NM_000157.3 | |
| GBA | Chr1:155211053 | c.-150A>G | NM_000157.3 | rs1232943445 |
| GINS1 | Chr20:25388397 | c.-60A>G | NM_021067.3 | |
| GINS1 | Chr20:25388409 | c.-48C>G | NM_021067.3 | |
| GPR143 | ChrX:9708630 | c.885+748G>A | NM_000273.2 | |
| GPR143 | ChrX:9711844 | c.659-131T>G | NM_000273.2 | |
| GSS | Chr20:33537864 | c.129+1663A>G | NM_000178.2 | |
| GSS | Chr20:33543525 | c.-9+5G>A | NM_000178.2 | |
| HBA1 | Chr16:227471 | c.*63_*65delCCT | NM_000558.3 | |
| HBA2 | Chr16:223646 | c.*47G>C | NM_000517.4 | rs4021971 |
| HBA2 | Chr16:223672 | c.*74_*89delCCTTCCTGGTCTTTGA | NM_000517.4 | rs63750919 |
| HBA2 | Chr16:223690 | c.*93_*94delAA | NM_000517.4 | rs63751268 |
| HBA2 | Chr16:223691 | c.*92A>G | NM_000517.4 | rs63750067 |
| HBA2 | Chr16:223693 | c.*94A>G | NM_000517.4 | |
| HBA2 | Chr16:223693 | c.*94A>C | NM_000517.4 | |
| HBA2 | Chr16:223703 | c.*104G>T | NM_000517.4 | |
| HBB | Chr11:5246696 | c.*132C>A | NM_000518.4 | rs1420779550 |
| HBB | Chr11:5246696 | c.*132C>T | NM_000518.4 | |
| HBB | Chr11:5246696 | c.*132C>A/T | NM_000518.4 | |
| HBB | Chr11:5246699 | c.*129T>C | NM_000518.4 | |
| HBB | Chr11:5246711 | c.*115_*116delAA | NM_000518.4 | rs281864532 |
| HBB | Chr11:5246713 | c.*110_*114delTAAAA | NM_000518.4 | rs606231219,rs35949130 |
| HBB | Chr11:5246715 | c.*113A>G | NM_000518.4 | rs33985472 |
| HBB | Chr11:5246716 | c.*112A>T | NM_000518.4 | |
| HBB | Chr11:5246716 | c.*112A>G | NM_000518.4 | |
| HBB | Chr11:5246716 | c.*110_*111delTA | NM_000518.4 | rs63750205,rs281864905 |
| HBB | Chr11:5246716 | c.*112A>G/T | NM_000518.4 | rs63750954 |
| HBB | Chr11:5246717 | c.*111A>G | NM_000518.4 | rs63751128 |
| HBB | Chr11:5246718 | c.*110T>G | NM_000518.4 | |
| HBB | Chr11:5246718 | c.*110T>A/C | NM_000518.4 | rs33978907 |
| HBB | Chr11:5246720 | c.*108A>C/G | NM_000518.4 | |
| HBB | Chr11:5246720 | c.*108A>C | NM_000518.4 | |
| HBB | Chr11:5246720 | c.*108A>G | NM_000518.4 | |
| HBB | Chr11:5246722 | c.*93_*105delATCTGGATTCTGC | NM_000518.4 | rs34171453 |
| HBB | Chr11:5246732 | c.*96T>C | NM_000518.4 | rs34029390 |
| HBB | Chr11:5246754 | c.*74A>G | NM_000518.4 | rs369101035 |
| HBB | Chr11:5246781 | c.*47C>G | NM_000518.4 | |
| HBB | Chr11:5246796 | c.*32A>C | NM_000518.4 | |
| HBB | Chr11:5246970 | c.316-14T>G | NM_000518.4 | rs35703285 |
| HBB | Chr11:5247046 | c.316-90A>G | NM_000518.4 | rs63750433 |
| HBB | Chr11:5247062 | c.316-106C>G | NM_000518.4 | rs34690599 |
| HBB | Chr11:5247102 | c.316-146T>G | NM_000518.4 | rs35328027 |
| HBB | Chr11:5247153 | c.316-197C>T | NM_000518.4 | rs34451549 |
| HBB | Chr11:5247216 | c.316-260T>C | NM_000518.4 | |
| HBB | Chr11:5247602 | c.315+203_315+205delTCTinsCC | NM_000518.4 | |
| HBB | Chr11:5248044 | c.93-15T>G | NM_000518.4 | rs35456885 |
| HBB | Chr11:5248050 | c.93-21G>A | NM_000518.4 | rs35004220 |
| HBB | Chr11:5248050 | c.93-22delT | NM_000518.4 | |
| HBB | Chr11:5248263 | c.-12C>T | NM_000518.4 | rs113115948 |
| HBB | Chr11:5248269 | c.-18C>G | NM_000518.4 | rs34135787 |
| HBB | Chr11:5248272 | c.-21T>A | NM_000518.4 | |
| HBB | Chr11:5248280 | c.-29G>A/T | NM_000518.4 | rs34704828 |
| HBB | Chr11:5248281 | c.-31delC | NM_000518.4 | |
| HBB | Chr11:5248282 | c.-31C>T | NM_000518.4 | rs63750628 |
| HBB | Chr11:5248291 | c.-41delT | NM_000518.4 | rs35352549 |
| HBB | Chr11:5248294 | c.-43C>T | NM_000518.4 | |
| HBB | Chr11:5248301 | c.-50A>C | NM_000518.4 | rs34305195 |
| HBB | Chr11:5248301 | c.-50A>G/T | NM_000518.4 | |
| HBB | Chr11:5248326 | c.-75G>T | NM_000518.4 | |
| HBB | Chr11:5248326 | c.-75G>C | NM_000518.4 | rs63750400 |
| HBB | Chr11:5248326 | NM_000518.4 | rs63750953 | |
| HBB | Chr11:5248327 | c.-76A>C | NM_000518.4 | rs281864525 |
| HBB | Chr11:5248328 | NM_000518.4 | ||
| HBB | Chr11:5248328 | NM_000518.4 | ||
| HBB | Chr11:5248328 | c.-77A>G/T | NM_000518.4 | |
| HBB | Chr11:5248329 | c.-78A>C/G | NM_000518.4 | rs33931746 |
| HBB | Chr11:5248329 | NM_000518.4 | ||
| HBB | Chr11:5248329 | NM_000518.4 | ||
| HBB | Chr11:5248330 | c.-79A>G | NM_000518.4 | rs34598529 |
| HBB | Chr11:5248330 | NM_000518.4 | rs397509430 | |
| HBB | Chr11:5248331 | NM_000518.4 | ||
| HBB | Chr11:5248331 | NM_000518.4 | ||
| HBB | Chr11:5248331 | c.-80T>A/C | NM_000518.4 | rs33980857 |
| HBB | Chr11:5248332 | c.-81A>C/G | NM_000518.4 | rs33981098 |
| HBB | Chr11:5248332 | NM_000518.4 | ||
| HBB | Chr11:5248332 | NM_000518.4 | ||
| HBB | Chr11:5248333 | NM_000518.4 | ||
| HBB | Chr11:5248333 | NM_000518.4 | ||
| HBB | Chr11:5248333 | c.-82C>A/T | NM_000518.4 | rs34500389 |
| HBB | Chr11:5248342 | c.-91A>C | NM_000518.4 | |
| HBB | Chr11:5248343 | c.-92C>G | NM_000518.4 | rs397515291 |
| HBB | Chr11:5248351 | c.-100G>A | NM_000518.4 | rs281864524 |
| HBB | Chr11:5248372 | c.-121C>T | NM_000518.4 | rs281864518 |
| HBB | Chr11:5248373 | NM_000518.4 | rs1272414751 | |
| HBB | Chr11:5248374 | c.-123A>T | NM_000518.4 | |
| HBB | Chr11:5248377 | c.-126C>A | NM_000518.4 | |
| HBB | Chr11:5248378 | c.-127G>C | NM_000518.4 | |
| HBB | Chr11:5248384 | NM_000518.4 | rs72561473 | |
| HBB | Chr11:5248387 | NM_000518.4 | ||
| HBB | Chr11:5248387 | NM_000518.4 | ||
| HBB | Chr11:5248387 | NM_000518.4 | ||
| HBB | Chr11:5248387 | c.-136C>A/G/T | NM_000518.4 | rs33994806 |
| HBB | Chr11:5248388 | c.-137C>A/G/T | NM_000518.4 | rs33941377 |
| HBB | Chr11:5248388 | NM_000518.4 | ||
| HBB | Chr11:5248388 | NM_000518.4 | ||
| HBB | Chr11:5248388 | NM_000518.4 | ||
| HBB | Chr11:5248389 | NM_000518.4 | ||
| HBB | Chr11:5248389 | NM_000518.4 | ||
| HBB | Chr11:5248389 | c.-138C>A/T | NM_000518.4 | rs33944208 |
| HBB | Chr11:5248391 | NM_000518.4 | rs34999973 | |
| HBB | Chr11:5248393 | c.-142C>T | NM_000518.4 | rs34883338 |
| HBB | Chr11:5248394 | c.-143C>G | NM_000518.4 | rs63751043 |
| HBB | Chr11:5248402 | c.-151C>T | NM_000518.4 | rs63751208 |
| HBB | Chr11:5248402 | NM_000518.4 | ||
| HBB | Chr11:5248403 | c.-152C>A | NM_000518.4 | |
| HBB | Chr11:5248491 | c.-240G>A | NM_000518.4 | rs753344875 |
| HBB | Chr11:5248524 | c.-273T>C | NM_000518.4 | rs139703273 |
| HFE | Chr6:26087649 | c.-20G>A | NM_000410.3 | rs138378000 |
| HK1 | Chr10:71038447 | c.-390-3838G>C | NM_033500.2 | rs797044964 |
| HK1 | Chr10:71038467 | c.-390-3818G>C | NM_033500.2 | rs397514654 |
| HK1 | Chr10:71075518 | c.27+14901A>G | NM_033500.2 | rs187500777 |
| HPS3 | Chr3:148888270 | c.2888-1612G>A | NM_032383.3 | rs281865096 |
| ITGA2B | Chr17:42449567 | c.*165T>C | NM_000419.3 | |
| ITGA2B | Chr17:42455177 | c.2095-19T>A | NM_000419.3 | |
| ITGA2B | Chr17:42458507 | c.1211-78A>G | NM_000419.3 | |
| ITGA2B | Chr17:42463181 | c.408+11C>A | NM_000419.3 | |
| ITGA2B | Chr17:42470923 | c.-4082G>A | NM_000419.3 | |
| KLF1 | Chr19:12998078 | c.-124T>C | NM_006563.3 | |
| KLF1 | Chr19:12998102 | NM_006563.3 | rs552824864 | |
| KLF1 | Chr19:12998108 | c.-154C>T | NM_006563.3 | rs372651309 |
| LAMTOR2 | Chr1:156028185 | c.*23C>A | NM_014017.3 | |
| LMAN1 | Chr18:57014710 | c.822+34_822+35insGTTG | NM_005570.3 | |
| MLH1 | Chr3:37034619 | c.-413_-411delGAG | NM_000249.3 | rs953169437 |
| MLH1 | Chr3:37034932 | c.-107C>G | NM_000249.3 | rs587778886 |
| MLH1 | Chr3:37034976 | c.-63_-58delGTGATTinsCACGAGGCACGAGCACGA | NM_000249.3 | |
| MLH1 | Chr3:37034997 | c.-42C>T | NM_000249.3 | rs41285097 |
| MLH1 | Chr3:37035012 | c.-27C>A | NM_000249.3 | rs587779001 |
| MLH1 | Chr3:37035260 | c.116+106G>A | NM_000249.3 | |
| MLH1 | Chr3:37038099 | c.117-11T>A | NM_000249.3 | rs267607711 |
| MLH1 | Chr3:37050292 | c.454-13A>G | NM_000249.3 | rs267607749 |
| MLH1 | Chr3:37061788 | c.885-9_887dupTCCTGACAGTTT | NM_000249.3 | rs63751620 |
| MLH1 | Chr3:37070436 | c.1558+13T>A | NM_000249.3 | rs267607834 |
| MSH2 | Chr2:47630106 | c.-225G>C | NM_000251.2 | rs138068023 |
| MSH2 | Chr2:47630150 | c.-181G>A | NM_000251.2 | rs786201698 |
| MSH2 | Chr2:47630249 | c.-81dupA | NM_000251.2 | rs560991330,rs587779187 |
| MSH2 | Chr2:47630251 | c.-78_-77delTG | NM_000251.2 | rs587779182 |
| MSH2 | Chr2:47698086 | c.1662-17dupG | NM_000251.2 | rs587779099 |
| MSH6 | Chr2:48018295 | c.457+33_457+34insGTGT | NM_000179.2 | |
| MSH6 | Chr2:48030536 | c.3173-16_3173-5delCCCTCTCTTTTA | NM_000179.2 | |
| MSH6 | Chr2:48034014 | c.*15A>C | NM_000179.2 | |
| MSH6 | Chr2:48034047 | c.*49_*68dupTTCAGACAACATTATGATCT | NM_000179.2 | rs777409019 |
| MTR | Chr1:236971838 | c.340-166A>G | NM_000254.2 | |
| MTR | Chr1:236977232 | c.609+1088G>A | NM_000254.2 | rs752526782 |
| MTR | Chr1:237057461 | c.3205-196A>G | NM_000254.2 | rs544410324 |
| NF1 | Chr17:29422055 | c.-273A>C | NM_001042492.2 | |
| NF1 | Chr17:29422056 | c.-272G>A | NM_001042492.2 | |
| NF1 | Chr17:29431417 | c.60+9031_60+9035delAAGTT | NM_001042492.2 | |
| NF1 | Chr17:29475515 | c.61-7486G>T | NM_001042492.2 | |
| NF1 | Chr17:29488136 | c.288+2025T>G | NM_001042492.2 | |
| NF1 | Chr17:29508426 | c.587-14T>A | NM_001042492.2 | |
| NF1 | Chr17:29508428 | c.587-12T>A | NM_001042492.2 | |
| NF1 | Chr17:29510334 | c.888+651T>A | NM_001042492.2 | |
| NF1 | Chr17:29510427 | c.888+744A>G | NM_001042492.2 | |
| NF1 | Chr17:29510472 | c.888+789A>G | NM_001042492.2 | |
| NF1 | Chr17:29527428 | c.889-12T>A | NM_001042492.2 | |
| NF1 | Chr17:29530107 | c.1260+1604A>G | NM_001042492.2 | |
| NF1 | Chr17:29533239 | c.1261-19G>A | NM_001042492.2 | |
| NF1 | Chr17:29534143 | c.1392+754T>G | NM_001042492.2 | |
| NF1 | Chr17:29540877 | c.1393-592A>G | NM_001042492.2 | |
| NF1 | Chr17:29542762 | c.1527+1159C>T | NM_001042492.2 | |
| NF1 | Chr17:29548419 | c.1642-449A>G | NM_001042492.2 | rs863224655 |
| NF1 | Chr17:29549489 | c.*481A>G | NM_001128147.2 | |
| NF1 | Chr17:29553439 | c.2002-14C>G | NM_001042492.2 | |
| NF1 | Chr17:29554225 | c.2252-11T>G | NM_001042492.2 | |
| NF1 | Chr17:29556025 | c.2410-18C>G | NM_001042492.2 | |
| NF1 | Chr17:29556027 | c.2410-16A>G | NM_001042492.2 | |
| NF1 | Chr17:29556028 | c.2410-15A>G | NM_001042492.2 | |
| NF1 | Chr17:29556031 | c.2410-12T>G | NM_001042492.2 | |
| NF1 | Chr17:29556839 | c.2851-14_2851-13insA | NM_001042492.2 | |
| NF1 | Chr17:29557267 | c.2991-11T>G | NM_001042492.2 | |
| NF1 | Chr17:29563299 | c.3974+260T>G | NM_001042492.2 | |
| NF1 | Chr17:29577082 | c.4110+945A>G | NM_001042492.2 | |
| NF1 | Chr17:29580296 | c.4173+278A>G | NM_001042492.2 | |
| NF1 | Chr17:29588708 | c.4578-20_4578-18delAAG | NM_001042492.2 | |
| NF1 | Chr17:29588715 | c.4578-14T>G | NM_001042492.2 | |
| NF1 | Chr17:29654479 | c.5269-38A>G | NM_001042492.2 | |
| NF1 | Chr17:29656858 | c.5610-456G>T | NM_001042492.2 | |
| NF1 | Chr17:29657848 | c.5812+332A>G | NM_001042492.2 | rs863224491 |
| NF1 | Chr17:29661577 | c.5813-279A>G | NM_001042492.2 | |
| NF1 | Chr17:29664375 | c.6428-11T>G | NM_001042492.2 | |
| NF1 | Chr17:29664618 | c.6642+18A>G | NM_001042492.2 | |
| NF1 | Chr17:29676126 | c.7190-12T>A | NM_001042492.2 | |
| NF1 | Chr17:29676127 | c.7190-11_7190-10insGTTT | NM_001042492.2 | |
| NF1 | Chr17:29685177 | c.7971-321C>G | NM_001042492.2 | |
| NF1 | Chr17:29685481 | c.7971-17C>G | NM_001042492.2 | |
| NF1 | Chr17:29685665 | c.8113+25A>T | NM_001042492.2 | |
| OCA2 | Chr15:28234823 | c.1117-11T>A | NM_000275.2 | |
| OCA2 | Chr15:28234829 | c.1117-17T>C | NM_000275.2 | rs200081580 |
| OCA2 | Chr15:28235808 | c.1045-15T>G | NM_000275.2 | rs779461179 |
| OCA2 | Chr15:28267738 | c.574-19A>G | NM_000275.2 | rs145242923 |
| PALB2 | Chr16:23649285 | c.109-12T>A | NM_024675.3 | rs774949203 |
| PARN | Chr16:14724045 | c.-165+2C>T | NM_001134477.2 | |
| PC | Chr11:66620883 | c.1369-29A>G | NM_000920.3 | |
| PDHA1 | ChrX:19371182 | c.533-17_533-14delTGTT | NM_001173454.1 | |
| PDHA1 | ChrX:19372579 | c.625-30G>A | NM_001173454.1 | |
| PDHA1 | ChrX:19373648 | c.873+26G>A | NM_001173454.1 | |
| PDHA1 | ChrX:19377849 | c.*79_*90dupAGTCAATGAAAT | NM_001173454.1 | rs606231192 |
| PDHA1 | ChrX:19377861 | c.*79_*90dupAGTCAATGAAAT | NM_001173454.1 | |
| PDHX | Chr11:34988372 | c.816+11C>G | NM_003477.2 | |
| PGK1 | ChrX:77381262 | c.1214-25T>G | NM_000291.3 | |
| PKLR | Chr1:155263185 | c.1269+44C>T | NM_000298.5 | |
| PKLR | Chr1:155265208 | c.507+20C>A | NM_000298.5 | |
| PKLR | Chr1:155271258 | c.-72A>G | NM_000298.5 | |
| PKLR | Chr1:155271259 | c.-73G>C | NM_000298.5 | |
| PKLR | Chr1:155271269 | c.-83G>C | NM_000298.5 | |
| PKLR | Chr1:155271269 | NM_000298.5 | rs1460844860 | |
| PMS2 | Chr7:6027263 | c.1145-31_1145-13delCTGACCCTCTTCTCCGTCC | NM_000535.5 | rs751973268 |
| PMS2 | Chr7:6048599 | c.23+21_23+28delTCCGGTGT | NM_000535.5 | |
| PROC | Chr2:128175983 | c.-107A>G | NM_000312.3 | |
| PROC | Chr2:128175984 | c.-106A>G | NM_000312.3 | |
| PROC | Chr2:128175988 | c.-102T>A | NM_000312.3 | |
| PROC | Chr2:128175991 | NM_000312.3 | ||
| PROC | Chr2:128175994 | c.-96T>G | NM_000312.3 | |
| PROC | Chr2:128176001 | c.-89T>C | NM_000312.3 | |
| PROC | Chr2:128176005 | c.-85C>T | NM_000312.3 | |
| PROC | Chr2:128176047 | c.-43A>C | NM_000312.3 | |
| PROC | Chr2:128176058 | c.-32G>A | NM_000312.3 | rs912629007 |
| PROC | Chr2:128179040 | c.237+15G>A | NM_000312.3 | rs528055589 |
| PROC | Chr2:128180582 | c.263-28T>G | NM_000312.3 | |
| PROC | Chr2:128180823 | c.401-18_401-3delGCCCTCCCCTGCCCGC | NM_000312.3 | |
| PROC | Chr2:128183562 | c.536-99C>G | NM_000312.3 | |
| PROC | Chr2:128186595 | c.*73C>T | NM_000312.3 | rs199469473 |
| PROS1 | Chr3:93593261 | c.1871-20_1871-13delCTAATATT | NM_000313.3 | |
| PROS1 | Chr3:93593263 | c.1871-14T>G | NM_000313.3 | rs754929347 |
| PROS1 | Chr3:93598175 | c.1493-17T>C | NM_000313.3 | rs199469501 |
| PROS1 | Chr3:93605147 | c.1323+33A>G | NM_000313.3 | |
| PROS1 | Chr3:93611983 | c.966-17C>G | NM_000313.3 | rs199469490 |
| PROS1 | Chr3:93692761 | c.-168C>T | NM_000313.3 | rs199469484 |
| PROS1 | Chr3:93692783 | c.-190C>G | NM_000313.3 | rs149028936 |
| PTPN11 | Chr12:112915602 | c.934-59T>A | NM_002834.3 | |
| RBM8A | Chr1:145507646 | c.-21G>A | NM_005105.4 | |
| RBM8A | Chr1:145507765 | c.67+32G>C | NM_005105.4 | rs201779890 |
| REN | Chr1:204129817 | c.374-12_374-11delTCinsAG | NM_000537.3 | |
| RPL31 | Chr2:101618778 | c.-1+1G>A | NM_001098577.2 | |
| RPL5 | Chr1:93300322 | c.190-12_191dupCTCTTACTATAGAT | NM_000969.3 | |
| RPS19 | Chr19:42364214 | c.-144_-141delTTTC | NM_001022.3 | |
| RPS26 | Chr12:56436176 | c.4-25_4-14delTAACAGTTTTCC | NM_001029.3 | |
| RPS7 | Chr2:3622941 | c.-19+1G>T | NM_001011.3 | |
| RPS7 | Chr2:3622942 | c.-19+2T>C | NM_001011.3 | |
| SEC23B | Chr20:18488060 | c.-571A>G | NM_006363.4 | rs559854357 |
| SEC23B | Chr20:18488615 | c.-16A>G | NM_006363.4 | |
| SEC23B | Chr20:18491731 | c.221+31A>G | NM_006363.4 | |
| SEC23B | Chr20:18491863 | c.221+163A>G | NM_006363.4 | rs573898514 |
| SEC23B | Chr20:18492791 | c.222-78C>T | NM_006363.4 | rs150393520 |
| SEC23B | Chr20:18526845 | c.1743+168A>G | NM_006363.4 | rs111951711 |
| SERPINC1 | Chr1:173876666 | c.1154-14G>A | NM_000488.3 | |
| SERPINC1 | Chr1:173884075 | c.42-18C>G | NM_000488.3 | |
| SERPINC1 | Chr1:173886568 | c.-171C>G | NM_000488.3 | |
| SH2D1A | ChrX:123499593 | c.138-17_138-11delAGTTTAT | NM_002351.4 | |
| SLC45A2 | Chr5:33985176 | NM_016180.3 | rs984225803 | |
| SLC45A2 | Chr5:33985764 | NM_016180.3 | rs199972025 | |
| SLC4A1 | Chr17:42340296 | c.-62G>A | NM_000342.3 | rs387906565 |
| SPTA1 | Chr1:158613314 | c.4339-99C>T | NM_003126.2 | rs200830867 |
| SPTA1 | Chr1:158626459 | c.2806-13T>G | NM_003126.2 | |
| STX11 | Chr6:144508713 | c.*85_*86insT | NM_003764.3 | |
| STXBP2 | Chr19:7705761 | c.326-23_326-16delGCCCCACT | NM_006949.3 | |
| TCN2 | Chr22:31011112 | c.581-176A>G | NM_000355.3 | rs372866837 |
| TCN2 | Chr22:31011112 | c.581-176A>T | NM_000355.3 | |
| TERC | Chr3:169482870 | n.-22C>T | NR_001566.1 | |
| TERC | Chr3:169482906 | NR_001566.1 | ||
| TERC | Chr3:169482948 | n.-100C>G | NR_001566.1 | rs199422256 |
| TERC | Chr3:169483086 | NR_001566.1 | rs199422255 | |
| TERT | Chr5:1271334 | c.2383-15C>T | NM_198253.2 | rs574645600 |
| TERT | Chr5:1295161 | c.-57A>C | NM_198253.2 | |
| THBD | Chr20:23030319 | NM_000361.2 | ||
| THBD | Chr20:23030443 | c.-302C>A | NM_000361.2 | |
| TP53 | Chr17:7571520 | NM_000546.5 | ||
| TP53 | Chr17:7577647 | c.673-39G>A | NM_000546.5 | |
| TP53 | Chr17:7579601 | c.97-11C>G | NM_000546.5 | |
| TP53 | Chr17:7590694 | c.-29+1G>T | NM_000546.5 | |
| TRNT1 | Chr3:3188088 | c.609-26T>C | NM_182916.2 | |
| TYR | Chr11:88960973 | c.1037-18T>G | NM_000372.4 | |
| UNC13D | Chr17:73826245 | c.2831-13G>A | NM_199242.2 | |
| UNC13D | Chr17:73827442 | c.2448-13G>A | NM_199242.2 | rs753762300 |
| UNC13D | Chr17:73839907 | c.118-307G>A | NM_199242.2 | |
| UNC13D | Chr17:73839908 | c.118-308C>T | NM_199242.2 | |
| VWF | Chr12:6101204 | c.6599-20A>T | NM_000552.3 | rs61750621 |
| VWF | Chr12:6125417 | c.5312-19A>G | NM_000552.3 | |
| VWF | Chr12:6128923 | c.3675-14G>A | NM_000552.3 | |
| VWF | Chr12:6233584 | c.-1+3A>C | NM_000552.3 | |
| VWF | Chr12:6233714 | c.-128G>A | NM_000552.3 | rs1300771136 |
| VWF | Chr12:6234258 | c.-672C>T | NM_000552.3 | rs61750447 |
| WAS | ChrX:48547690 | c.1339-19_1339-11delTGATCCCTGinsATCTGCAGACC | NM_000377.2 |
Test Strengths
The strengths of this test include:
- CAP accredited laboratory
- CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
- Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
- Careful construction of clinically effective and scientifically justified gene panels
- Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
- Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
- ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section)
- Our rigorous variant classification scheme
- Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
- Our comprehensive clinical statements
Test Limitations
The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: CSF2RA NM_001161530.2:11, HK1 NM_001322365.2:5, PGM3 NM_001199919.2:14, PMS2 NM_000535.7:13-15, RPL15 NM_001253384.2:5, VKORC1 NM_001311311.2:3, VPS45 NM_001279353.2:13. Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene's target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).
This test does not detect the following:
- Complex inversions
- Gene conversions
- Balanced translocations
- Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
- Repeat expansion disorders unless specifically mentioned
- Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).
This test may not reliably detect the following:
- Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
- Stretches of mononucleotide repeats
- Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
- Indels larger than 50bp
- Single exon deletions or duplications
- Variants within pseudogene regions/duplicated segments
- Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.
The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.
For additional information, please refer to the Test performance section.
The genes on the panels have been carefully selected based on scientific literature, mutation databases and our experience.
The panels are sectioned from our high-quality, clinical grade NGS assay. The panel analysis is a combination of both sequence variants (SNVs and indels) as well as deletions and duplications (copy number variants (CNV)).
Please refer to the table below for performance metrics of the analytical validation of the assay. The validation includes the evaluation of reference samples to determine the capability of the assay to detect various types of variants. The sensitivity values quoted in the analytic validation may not precisely reflect the performance in a production setting and is not a guarantee of the assay’s clinical performance. The provided performance metrics are based on a validation conducted at our laboratory in Finland. The assay has been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva, and dried blood spots (filter cards).
Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.
Analytical sensitivity to detect single-nucleotide variants and indels were calculated using both versions v3.3.2 and v4.2.1 of high-confidence region benchmark data provided by Genome in a Bottle (GIAB) consortium. Version 4.2.1 is extended to include challenging medically relevant regions and other difficult to map regions. Version 4.2.1 covers 94.1% of reference (GRCh37) and v3.3.2 covers 87.8% of reference. For more information, see GIAB publication https://doi.org/10.1016/j.xgen.2022.100128.
| Sensitivity % (TP/(TP+FN) | Specificity % | |||
|---|---|---|---|---|
| GIAB Version 3.3.2 | GIAB Version 4.2.1 | GIAB Version 3.3.2 | GIAB Version 4.2.1 | |
| Single nucleotide variants | 99.57 % | 97.58 % | 100 % | 100 % |
| Insertions, deletions | ||||
| 1-10 bps | 95.38 % | 95.13 % | 100.00 % | 100.00 % |
| 11-20 bps | 99.09 % | 98.15 % | 100.00 % | 100.00 % |
| 21-50 bps | 98.78 % | 98.85 % | 100.00 % | 100.00 % |
| 2-50 bps | 97.62 % | 97.41 % | 100.00 % | 100.00 % |
| Copy number variants (exon level dels/dups, clinical sample performance) | Sensitivity | Specificity | ||
| 1 exon level deletion (heterozygous) | 100% (14/14) | NA | ||
| 1 exon deletion (homozygous or hemizygous) | 100% (5/5) | NA | ||
| 2-4 exon deletion (heterozygous or homozygous) | 100% (17/17) | NA | ||
| 5-33 exon deletion (heterozygous) | 100% (12/12) | NA | ||
| 1-5 exon duplication (heterozygous or homozygous) | 77% (10/13) | NA | ||
| 9-31 exon duplication (heterozygous) | 100% (7/7) | NA | ||
| Simulated CNV detection in reference samples (n=10) | Sensitivity | |||
| 5 exon level deletion/duplication | 98 % | |||
| Microdeletion/-duplication syndromes (large CNVs, n=22)) | ||||
| Size range (0.1-47 Mb) | 100% (22/22) | |||
| The performance presented above was reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics | ||||
| Average of median sequencing depths in reference samples | 136x | |||
| Nucleotides with >20x sequencing coverage (%) | 99.77% | |||
Performance of Blueprint Genetics Mitochondrial Sequencing Assay.
| ANALYTIC VALIDATION (reference samples; n=4) | Sensitivity % | |||
| Single nucleotide variants | ||||
| Heteroplasmic (45-100%) | 100.0% (50/50) | |||
| Heteroplasmic (35-45%) | 100.0% (87/87) | |||
| Heteroplasmic (25-35%) | 100.0% (73/73) | |||
| Heteroplasmic (15-25%) | 100.0% (74/74) | |||
| Heteroplasmic (5-15%) | 100.0% (79/79) | |||
| Heteroplasmic (<5%) | 53.3 % (8/15) | |||
| CLINICAL VALIDATION (n=20 samples) | ||||
| Single nucleotide variants (n=18 SNVs) | 100.0% (3/3) | |||
| Heteroplasmic (10-15%) | 100.0% (5/5) | |||
| Heteroplasmic (5-10%) | 100.0% (5/5) | |||
| Heteroplasmic (<5%) | 20% (1/5) | |||
| Insertions and deletions by sequence analysis (n=3) | ||||
| Heteroplasmic (45-100%) 1-10bp | 100.0% (3/3) | |||
| Validation of the mitochondrial genome analysis workflow (based on simulated data of pathogenic mitomap mutations) | ||||
| Insertions and deletions 1-24 bps by sequence analysis; n=17 | ||||
| Homoplasmic (100%) 1-24bp | 100.0% (17/17) | |||
| Heteroplasmic (50%) | 100.0% (17/17) | |||
| Heteroplasmic (25%) | 100.0% (17/17) | |||
| Heteroplasmic (20%) | 100.0% (17/17) | |||
| Heteroplasmic (15%) | 100.0% (17/17) | |||
| Heteroplasmic (10%) | 94.1% (16/17) | |||
| Heteroplasmic (5%) | 94.1% (16/17) | |||
| Copy number variants (separate artifical mutations; n=1500) | ||||
| Homoplasmic (100%) 500 bp, 1kb, 5 kb | 100.0% | |||
| Heteroplasmic (50%) 500 bp, 1kb, 5 kb | 100.0% | |||
| Heteroplasmic (30%) 500 bp, 1kb, 5 kb | 100.0% | |||
| Heteroplasmic (20%) 500 bp, 1kb, 5 kb | 99.7% | |||
| Heteroplasmic (10%) 500 bp, 1kb, 5 kb | 99.0% | |||
| Following mtDNA coverage metrics were obtained in clinical samples in the assay validation (n=238) | ||||
| Mean of medians | ||||
| Mean sequencing depth MQ0 | 6334x | |||
| Nucleotides with >1000x MQ0 sequencing coverage (%) | 100% | |||
| rho zero cell line (=no mtDNA), mean sequencing depth in mitochondrial assay validation | 12X | |||
The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. If the test includes the mitochondrial genome the target region gene list contains the mitochondrial genes. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as SIFT, PolyPhen,MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with suboptimal coverage (<20X for nuclear genes and <1000X for mtDNA) if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.
We provide customers with comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our Ph.D. molecular geneticists, medical professionals, and other highly experienced experts prepare clinical reports by evaluating the identified variants in the context of the phenotypic information provided in the requisition form.
Our goal is to provide clinically meaningful reports that are understandable for all medical professionals regardless of whether they have formal training in genetics. Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015. Sequence and copy number variants classified as pathogenic, likely pathogenic, and variants of uncertain significance (VUS) are confirmed using bidirectional Sanger sequencing or by orthogonal methods such as qPCR/ddPCR when they do not meet our stringent NGS quality metrics for a true positive call.
Our clinical report includes tables for sequence and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, phenotypes, and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene, and phenotype(s), including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts, and detailed information about related phenotypes. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired.
The panel report is divided into primary findings and additional findings sections. Variants reported as primary findings are known disease-causing variants or rare variants that could potentially explain the patient’s phenotype as described to the laboratory at the time of interpretation. The conclusion summarizes all the existing information and provides our rationale for the classification of the variant.
Variants reported as additional findings are variants that are not likely or sufficient to cause the tested patient’s phenotype, based on the current knowledge. Additional findings in panel reports include variants that are, for example, carrierships of single heterozygous variants in genes associated with autosomal recessive disorders, variants of uncertain significance in genes associated with autosomal dominant disorders (if pathogenic or likely pathogenic variants considered sufficient to explain the patient’s phenotype are reported as primary findings), or risk alleles identified in genes included in the panel.
Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.
Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well positioned to reclassify previously reported variants as new information becomes available. If a variant previously reported as a primary or secondary finding by Blueprint Genetics is reclassified so that it becomes diagnostic (VUS to P/LP) or earlier molecular diagnosis is removed (P/LP to VUS, LB, B), our laboratory will issue a follow-up statement to the original ordering healthcare provider at no additional cost.
Other
- American Sickle Cell Anemia Association
- Bernard Soulier Syndrome Organization
- Bloom’s Syndrome Association
- Bousfiha A et al. The 2017 IUIS Phenotypic Classification for Primary Immunodeficiencies. J Clin Immunol. 2018 38:129–143
- Diamond Blackfan Anemia Foundation
- Fanconi Anemia Research Fund
- GeneReviews - Alpha-Thalassemia
- GeneReviews - Beta-Thalassemia
- GeneReviews - Bloom Syndrome
- GeneReviews - Chediak-Higashi Syndrome
- GeneReviews - Congenital Dyserythropoietic Anemia
- GeneReviews - Congenital Dyserythropoietic Anemia Type I
- GeneReviews - Diamond-Blackfan Anemia
- GeneReviews - Diamond-Blackfan anemia
- GeneReviews - EPB42-Related Hereditary Spherocytosis
- GeneReviews - Familial Hemophagocytic Lymphohistiocytosis
- GeneReviews - Fanconi Anemia
- GeneReviews - Hemophagocytic Lymphohistiocytosis, Familial
- GeneReviews - Hemophilia A
- GeneReviews - Hemophilia B
- GeneReviews - Hermansky-Pudlak Syndrome
- GeneReviews - Lymphoproliferative Disease, X-Linked
- GeneReviews - Lymphoproliferative Syndrome
- GeneReviews - Nijmegen Breakage Syndrome
- GeneReviews - Shwachman-Diamond Syndrome
- GeneReviews - Sickle Cell Disease
- GeneReviews - Von Willebrand Disease
- GeneReviews - WAS-Related Disorders
- GeneReviews - Wiskott Aldrich Syndrome
- GeneReviews - X-Linked Sideroblastic Anemia
- GeneReviews - X-Linked Sideroblastic Anemia and Ataxia
- Glanzmann’s Research Foundation
- Hemophilia & Rare Bleeding Disorders
- Hemophilia Federation of America
- Hermansky-Pudlak Syndrome Network
- Histiocytosis Association
- Immune Deficiency Foundation
- NORD - Bernard-Soulier Syndrome
- NORD - Beta-Thalassemia
- NORD - Bloom Syndrome
- NORD - Chediak-Higashi Syndrome
- NORD - Diamond-Blackfan anemia
- NORD - Fanconi Anemia
- NORD - Glanzmann Thrombasthenia
- NORD - Hemophilia A
- NORD - Hemophilia B
- NORD - Hereditary Spherocytosis
- NORD - Hermansky-Pudlak Syndrome
- NORD - Lymphoproliferative Syndrome
- NORD - Shwachman-Diamond Syndrome
- NORD - Sickle Cell Disease
- NORD - Von Willebrand Disease
- NORD - Wiskott Aldrich Syndrome
- National Hemophilia Foundation
- National Organization for Albinism and Hypopigmentation
- Noris P et al. Hereditary thrombocytopenias: a growing list of disorders. Hematology Am Soc Hematol Educ Program. 2017 Dec 8; (1):385-399
- Platelet Disorder Support Association
- Shwachman-Diamond Syndrome Foundation
- Thalassemia Support Foundation
- Wiskott-Aldrich Foundation
- World Federation of Hemophilia