Bone Marrow Failure Syndrome Panel

Summary
Is a 156 gene panel that includes assessment of non-coding variants.

Is ideal for patients with a clinical suspicion of inherited bone marrow failure syndromes. The genes on this panel are included in the Comprehensive Hematology Panel. This panel is designed to detect heritable germline mutations and should not be used for the detection of somatic mutations in tumor tissue.

Analysis methods
  • PLUS
Availability
4 weeks
Number of genes
156
Test code
HE0801
Panel tier
Tier 4
* The CPT codes provided are based on AMA guidelines and are for informational purposes only. CPT coding is the sole responsibility of the billing party. Please direct any questions regarding coding to the payer being billed.

Summary

The Blueprint Genetics Bone Marrow Failure Syndrome Panel (test code HE0801):

Read about our accreditations, certifications and CE-marked IVD medical devices here.

ICD Codes

Refer to the most current version of ICD-10-CM manual for a complete list of ICD-10 codes.

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Please see Sample Requirements for accepted saliva kits)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.

Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.

Read more about our sample requirements here.

Inherited bone marrow failure syndromes (IBMFS) are a diverse set of genetic disorders characterized by the inability of the bone marrow to produce sufficient circulating blood cells. Bone marrow failure can affect all blood cell lineages causing clinical symptoms similar to aplastic anemia, or be restricted to one or two blood cell lineages. The clinical presentation may include thrombocytopenia or neutropenia. Hematological manifestations may be accompanied by physical features such as short stature and abnormal skin pigmentation in Fanconi anemia and dystrophic nails, lacy reticular pigmentation and oral leukoplakia in dyskeratosis congenita. Patients with IBMFS have an increased risk of developing cancer—either hematological or solid tumors. Early and correct disease recognition is important for management and surveillance of the diseases. Currently, accurate genetic diagnosis is essential to confirm the clinical diagnosis. The most common phenotypes that are covered by the panel are Fanconi anemia, Diamond-Blackfan anemia, dyskeratosis congenita, Shwachman-Diamond syndrome and WAS-related disorders.

Genes in the Bone Marrow Failure Syndrome Panel and their clinical significance

To view complete table content, scroll horizontally.

Gene Associated phenotypes Inheritance ClinVar HGMD
ACD Dyskeratosis congenita, autosomal dominant 6, Dyskeratosis congenita, autosomal recessive 7 AD/AR 2 8
ACTB* Baraitser-Winter syndrome AD 55 60
AK2 Reticular dysgenesis AR 14 17
ALAS2 Anemia, sideroblastic, Protoporphyria, erythropoietic XL 27 103
ANKRD26 Thrombocytopenia AD 6 21
AP3B1 Hermansky-Pudlak syndrome AR 14 34
ATM Breast cancer, Ataxia-Telangiectasia AD/AR 1047 1109
ATR Cutaneous telangiectasia and cancer syndrome, Seckel syndrome AD/AR 10 33
BLM Bloom syndrome AR 152 119
BLOC1S3 Hermansky-Pudlak syndrome AR 2 4
BLOC1S6 Hermansky-Pudlak syndrome AR 1 2
BRAF* LEOPARD syndrome, Noonan syndrome, Cardiofaciocutaneous syndrome AD 134 65
BRCA1* Pancreatic cancer, Breast-ovarian cancer, familial AD 2997 2631
BRCA2 Fanconi anemia, Medulloblastoma, Glioma susceptibility, Pancreatic cancer, Wilms tumor, Breast-ovarian cancer, familial AD/AR 3369 2659
BRIP1 Fanconi anemia, Breast cancer AD/AR 238 189
C15ORF41 Congenital dyserythropoietic anemia AR 3 3
C6ORF25 1 1
CBL Noonan syndrome-like disorder with or without juvenile myelomonocytic leukemia AD 24 43
CDAN1 Anemia, dyserythropoietic congenital AR 12 61
CDKN2A Melanoma, familial, Melanoma-pancreatic cancer syndrome AD 87 232
CEBPA Acute myeloid leukemia, familial AD 15 13
CLPB 3-methylglutaconic aciduria with cataracts, neurologic involvement, and neutropenia (MEGCANN) AR 26 25
CSF2RA#* Surfactant metabolism dysfunction, pulmonary XL 2 17
CSF3R Neutrophilia, hereditary AD/AR 13 13
CTC1 Cerebroretinal microangiopathy with calcifications and cysts AR 21 33
CTSC Periodontitis, juvenile, Haim-Munk syndrome, Papillon-Lefevre syndrome AR 19 92
CXCR4 Warts, hypogammaglobulinemia, infections, and myelokathexis (WHIM) syndrome AD 5 15
DDX41 Familial myeloproliferative/lymphoproliferative neoplasms, multiple types, susceptibility to AD 9 21
DKC1 Hoyeraal-Hreidarsson syndrome, Dyskeratosis congenita XL 48 74
DNAJC21 Bone marrow failure syndrome 3 AR 5 11
DNASE2 Primary immunodeficiency 2
DTNBP1 Hermansky-Pudlak syndrome AR 2 3
EFL1* Shwachman-Diamond syndrome 3 2
ELANE Neutropenia AD 43 217
EPCAM Diarrhea 5, with tufting enteropathy, congenital, Colorectal cancer, hereditary nonpolyposis AD/AR 38 80
ERCC4 Fanconi anemia, Xeroderma pigmentosum, XFE progeroid syndrome AR 13 70
ERCC6L2 Bone marrow failure syndrome 2 AR 4 9
ETV6 Thrombocytopenia 5 AD 10 38
FADD Infections, recurrent, with encephalopathy, hepatic dysfunction, and cardiovascular malformations AR 2 1
FANCA Fanconi anemia AR 191 677
FANCB Fanconi anemia XL 11 21
FANCC Fanconi anemia AR 94 64
FANCD2* Fanconi anemia AR 21 61
FANCE Fanconi anemia AR 4 17
FANCF Fanconia anemia AR 7 16
FANCG Fanconi anemia AR 16 92
FANCI Fanconi anemia AR 13 45
FANCL Fanconi anemia AR 13 24
FANCM Fanconi anemia AR 6 50
FAS Autoimmune lymphoproliferative syndrome AD/AR 31 133
FASLG Autoimmune lymphoproliferative syndrome, type IB AD 2 10
G6PC3 Neutropenia, severe congenital, Dursun syndrome AR 11 37
GATA1 Anemia, without thrombocytopenia, Thrombocytopenia with beta-thalessemia,, Dyserythropoietic anemia with thrombocytopenia XL 21 15
GATA2 Myelodysplastic syndrome, Chronic neutropenia associated with monocytopenia, evolving to myelodysplasia and acute myeloid leukemia, Acute myeloid leukemia, Emberger syndrome, Immunodeficiency AD 30 142
GFI1 Neutropenia, severe congenital, 2 autosomal dominant, Neutropenia, nonimmune chronic idiopathic, of adults AD 2 6
GINS1 Immunodeficiency AR 4 4
GLRX5 Spasticity, childhood-onset, with hyperglycinemia AR 5 6
GP1BA Pseudo-von Willebrand disease, Bernard-Soulier syndrome AD/AR 9 73
HAX1 Neutropenia, severe congenital AR 11 21
HPS1* Hermansky-Pudlak syndrome AR 28 55
HPS3* Hermansky-Pudlak syndrome AR 10 17
HPS4 Hermansky-Pudlak syndrome AR 16 22
HPS5 Hermansky-Pudlak syndrome AR 20 31
HPS6 Hermansky-Pudlak syndrome AR 13 37
HRAS Costello syndrome, Congenital myopathy with excess of muscle spindles AD 43 31
IFNGR2 Immunodeficiency AR 4 18
IKZF1 Immunodeficiency, common variable, 13 AD 10 35
ITGA2B Glanzmann thrombasthenia AD/AR 22 234
ITK Lymphoproliferative syndrome AR 4 11
JAGN1 Neutropenia, severe congenital AR 8 8
KCNN4 Dehydrated hereditary stomatocytosis 2 AD 3 3
KRAS* Noonan syndrome, Cardiofaciocutaneous syndrome AD 63 35
LAMTOR2 Immunodeficiency due to defect in MAPBP-interacting protein AR 1 1
LYST* Chediak-Higashi syndrome AR 50 97
MAGT1 Immunodeficiency, with magnesium defect, Epstein-Barr virus infection and neoplasia, Mental retardation, X-linked 95 XL 8 14
MAP2K1 Cardiofaciocutaneous syndrome AD 45 23
MAP2K2 Cardiofaciocutaneous syndrome AD 21 35
MECOM Radioulnar synostosis with amegakaryocytic thrombocytopenia 2 AD 3 27
MKL1 Primary immunodeficiency AR 4
MLH1 Muir-Torre syndrome, Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 873 1191
MPL Thrombocythemia, Amegakaryocytic thrombocytopenia AD/AR 23 55
MSH2 Muir-Torre syndrome, Endometrial cancer, Colorectal cancer, hereditary nonpolyposis,, Mismatch repair cancer syndrome AD/AR 933 1249
MSH6 Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 672 586
MYH9 Sebastian syndrome, May-Hegglin anomaly, Epstein syndrome, Fechtner syndrome, Macrothrombocytopenia and progressive sensorineural deafness, Deafness, autosomal dominant 17 AD 25 117
MYO5A Griscelli syndrome AR 7 9
NAF1 AD 2
NBN Breast cancer, Nijmegen breakage syndrome, demonstrating report layout issue with very long condition descriptions AD/AR 188 97
NF1* Watson syndrome, Neurofibromatosis, Neurofibromatosis-Noonan syndrome AD 1157 2901
NHP2 Dyskeratosis congenita AR 5 3
NOP10 Dyskeratosis congenita AR 1 1
NRAS Noonan syndrome AD 31 14
OBFC1 2 2
PALB2 Fanconi anemia, Pancreatic cancer, Breast cancer AD/AR 495 406
PARN* Pulmonary fibrosis and/or bone marrow failure, Dyskeratosis congenita AD/AR 15 29
PAX5 Pre-B cell acute lymphoblastic leukemia AD 7
PGM3# Immunodeficiency 23 AR 14 15
PMS2#* Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 319 342
POT1 Glioma susceptibility 9, Melanoma, cutaneous malignant, susceptibility to 10 AD 2 34
PRF1 Lymphoma, non-Hodgkin, Aplastic anemia, adult-onset, Hemophagocytic lymphohistiocytosis AR 24 183
PTPN11 Noonan syndrome, Metachondromatosis AD 135 140
RAB27A Griscelli syndrome, Elejalde syndrome AR 18 54
RAC2 Neutrophil immunodeficiency syndrome AD 2 3
RAD51C Fanconi anemia, Breast-ovarian cancer, familial AD/AR 107 125
RBM8A* Thrombocytopenia - absent radius AD/AR 5 12
RECQL4 Baller-Gerold syndrome, RAPADILINO syndrome, Rothmund-Thomson syndrome AR 82 114
RIT1 Noonan syndrome AD 23 26
RPL11 Diamond-Blackfan anemia AD 12 45
RPL15#* Diamond-Blackfan anemia AD 2 2
RPL26 Diamond-Blackfan anemia 11 AD 2 1
RPL27 Diamond-Blackfan anemia 16 1 1
RPL31 Diamond-Blackfan anemia AD 2
RPL35A Diamond-Blackfan anemia AD 7 14
RPL5 Diamond-Blackfan anemia AD 19 77
RPS10 Diamond-Blackfan anemia AD 3 5
RPS19 Diamond-Blackfan anemia AD 23 172
RPS24 Diamond-Blackfan anemia AD 6 10
RPS26 Diamond-Blackfan anemia AD 10 33
RPS28 Diamond-Blackfan anemia 15 with mandibulofacial dysostosis AD 1 1
RPS29 Diamond-Blackfan anemia AD 4 4
RPS7 Diamond-Blackfan anemia AD 2 10
RTEL1 Pulmonary fibrosis and/or bone marrow failure, Dyskeratosis congenita AD/AR 58 51
RUNX1 Platelet disorder, familial, with associated myeloid malignancy AD 47 101
SAMD9 Mirage syndrome, Tumoral calcinosis, normophosphatemic AD/AR 10 27
SAMD9L Ataxia-pancytopenia syndrome AD 4 16
SBDS* Aplastic anemia, Shwachman-Diamond syndrome, Severe spondylometaphyseal dysplasia AR 19 90
SEC23B Anemia, dyserythropoietic congenital AR 18 121
SH2D1A Lymphoproliferative syndrome XL 21 129
SLC19A2 Thiamine-responsive megaloblastic anemia syndrome AR 14 51
SLC25A38 Anemia, sideroblastic 2, pyridoxine-refractory AR 7 27
SLC37A4 Glycogen storage disease AR 49 113
SLX4 Fanconi anemia AR 18 72
SMARCD2 Specific granule defiency 2 AR 3 1
SOS1 Noonan syndrome AD 44 71
SRP54 Shwachman-Diamond syndrome AD 3
SRP72* Bone marrow failure syndrome 1 AD 2 5
STX11 Hemophagocytic lymphohistiocytosis, familial AR 8 22
STXBP2 Hemophagocytic lymphohistiocytosis, familial AR 12 77
TBXAS1 Ghosal hematodiaphyseal syndrome AR 7 6
TERC Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita AD 42 73
TERT Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita AD/AR 48 156
THPO Thrombocythemia 1 AD 5 10
TINF2 Revesz syndrome, Dyskeratosis congenita AD 25 42
TP53 Colorectal cancer, Li-Fraumeni syndrome, Ependymoma, intracranial, Choroid plexus papilloma, Breast cancer, familial, Adrenocortical carcinoma, Osteogenic sarcoma, Hepatoblastoma, Non-Hodgkin lymphoma AD 393 505
TUBB1 Macrothrombocytopenia AD 2 7
UBE2T Fanconi anemia, complementation group T AR 2 7
UNC13D Hemophagocytic lymphohistiocytosis, familial AR 22 192
USB1 Poikiloderma with neutropenia AR 24 22
VPS13B Cohen syndrome AR 351 203
VPS45# Neutropenia, severe congenital, 5, autosomal recessive AR 3 4
WAS Neutropenia, severe congenital, Thrombocytopenia, Wiskott-Aldrich syndrome XL 57 439
WDR1 AR 8
WIPF1 Wiskott-Aldrich syndrome 2 AR 2 3
WRAP53 Dyskeratosis congenita AR 7 6
XIAP* Lymphoproliferative syndrome XL 14 96
XRCC2 Hereditary breast cancer AD/AR 10 21
ZCCHC8 1
#

The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.

*

Some, or all, of the gene is duplicated in the genome. Read more.

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.

Non-coding variants covered by Bone Marrow Failure Syndrome Panel

To view complete table content, scroll horizontally.

Gene Genomic location HG19 HGVS RefSeq RS-number
ALAS2 ChrX:55054634 c.-15-2186C>G NM_000032.4
ALAS2 ChrX:55054635 c.-15-2187T>C NM_000032.4
ALAS2 ChrX:55054636 c.-15-2188A>G NM_000032.4
ALAS2 ChrX:55057393 c.-34C>T NM_000032.4 rs780642606
ALAS2 ChrX:55057617 c.-258C>G NM_000032.4 rs140772352
ANKRD26 Chr10:27389371 c.-116C>G NM_014915.2
ANKRD26 Chr10:27389373 c.-118C>A NM_014915.2
ANKRD26 Chr10:27389374 c.-119C>A NM_014915.2
ANKRD26 Chr10:27389374 c.-119C>A/G NM_014915.2
ANKRD26 Chr10:27389376 c.-121A>C NM_014915.2
ANKRD26 Chr10:27389380 c.-127_-126delAT NM_014915.2
ANKRD26 Chr10:27389381 c.-126T>C NM_014915.2
ANKRD26 Chr10:27389381 c.-126T>G NM_014915.2
ANKRD26 Chr10:27389382 c.-127A>G NM_014915.2
ANKRD26 Chr10:27389382 c.-127A>T NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>T NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>A NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>C NM_014915.2
ANKRD26 Chr10:27389389 c.-134G>A NM_014915.2 rs863223318
ATM Chr11:108093770 c.-174A>G NM_000051.3
ATM Chr11:108094508 c.-31+595G>A NM_000051.3
ATM Chr11:108098321 c.-30-1G>T NM_000051.3 rs869312754
ATM Chr11:108138753 c.2639-384A>G NM_000051.3
ATM Chr11:108141209 c.2839-579_2839-576delAAGT NM_000051.3
ATM Chr11:108151710 c.3403-12T>A NM_000051.3 rs201370733
ATM Chr11:108158168 c.3994-159A>G NM_000051.3 rs864622543
ATM Chr11:108164028 c.4612-12A>G NM_000051.3
ATM Chr11:108179837 c.5763-1050A>G NM_000051.3 rs774925473
ATM Chr11:108214779 c.8418+681A>G NM_000051.3 rs748635985
BRCA1 Chr17:41196352 c.*1340_*1342delTGT NM_007294.3 rs1281551853
BRCA1 Chr17:41196424 c.*1271T>C NM_007294.3
BRCA1 Chr17:41197167 c.*528G>C NM_007294.3 rs1060504556
BRCA1 Chr17:41197588 c.*103_*106delTGTC NM_007294.3 rs431825382
BRCA1 Chr17:41197637 c.*58C>T NM_007294.3 rs137892861
BRCA1 Chr17:41197859 c.5468-40T>A NM_007294.3 rs80358151
BRCA1 Chr17:41199745 c.5407-25T>A NM_007294.3 rs758780152
BRCA1 Chr17:41201232 c.5333-36_5333-22delTACTGCAGTGATTTT NM_007294.3
BRCA1 Chr17:41206122 c.5277+2916_5277+2946delAAATTCTAGTGCTTTGGATTTTTTCCTCCATinsGG NM_007294.3
BRCA1 Chr17:41209164 c.5194-12G>A NM_007294.3 rs80358079
BRCA1 Chr17:41215994 c.5075-27delA NM_007294.3
BRCA1 Chr17:41251909 c.442-22_442-13delTGTTCTTTAC NM_007294.3 rs879254224
BRCA1 Chr17:41256984 c.213-11T>G NM_007294.3 rs80358061
BRCA1 Chr17:41256985 c.213-12A>G NM_007294.3 rs80358163
BRCA1 Chr17:41256988 c.213-15A>G NM_007294.3
BRCA1 Chr17:41276134 c.-19-2A>G NM_007294.3
BRCA2 Chr13:32889805 c.-40+1G>A NM_000059.3
BRCA2 Chr13:32890469 c.-39-89delC NM_000059.3
BRCA2 Chr13:32890556 c.-39-1_-39delGA NM_000059.3 rs758732038
BRCA2 Chr13:32890558 c.-39-1G>A NM_000059.3 rs1060499566
BRCA2 Chr13:32900222 c.426-12_426-8delGTTTT NM_000059.3 rs276174844
BRCA2 Chr13:32945079 c.8488-14A>G NM_000059.3
BRCA2 Chr13:32953872 c.8954-15T>G NM_000059.3
BRCA2 Chr13:32971007 c.9502-28A>G NM_000059.3 rs397508059
BRCA2 Chr13:32971023 c.9502-12T>G NM_000059.3 rs81002803
BRIP1 Chr17:59858864 c.1629-498A>T NM_032043.2
CDKN2A Chr9:21968346 c.458-105A>G NM_000077.4
CDKN2A Chr9:21973573 c.150+1104C>A NM_000077.4 rs756102261
CDKN2A Chr9:21974401 c.*73+2T>G NM_058197.4
CDKN2A Chr9:21974847 c.-21C>T NM_000077.4
CDKN2A Chr9:21974875 c.-49C>A NM_000077.4 rs1064797383
CDKN2A Chr9:21974882 c.-56G>T NM_000077.4
CDKN2A Chr9:21974916 c.-93_-91delAGG NM_000077.4
CTSC Chr11:88070895 c.-55C>A NM_001814.4 rs766114323
DKC1 ChrX:153991099 c.-142C>G NM_001363.3 rs199422241
DKC1 ChrX:153991100 c.-141C>G NM_001363.3
DKC1 ChrX:153993704 c.85-15T>C NM_001363.3
EPCAM Chr2:47606078 c.556-14A>G NM_002354.2 rs376155665
FANCA Chr16:89805127 c.4261-19_4261-12delACCTGCTC NM_000135.3
FANCA Chr16:89816056 c.3239+82T>G NM_000135.2
FANCA Chr16:89818822 c.2982-192A>G NM_000135.2
FANCA Chr16:89831215 c.2778+83C>G NM_000135.2 rs750997715
FANCA Chr16:89836111 c.2504+134A>G NM_000135.2
FANCA Chr16:89836805 c.2223-138A>G NM_000135.2
FANCA Chr16:89849346 c.1567-20A>G NM_000135.2 rs775154397
FANCC Chr9:98011653 c.-78-2A>G NM_000136.2 rs587779898
FANCC Chr9:98079807 c.-79+1G>A NM_000136.2
FANCD2 Chr3:10083186 c.696-121C>G NM_033084.3
FANCD2 Chr3:10102127 c.1766+40T>G NM_033084.3
FANCD2 Chr3:10106024 c.1948-16T>G NM_033084.3
FANCI Chr15:89825208 c.1583+142C>T NM_001113378.1
FANCL Chr2:58433394 c.375-2033C>G NM_001114636.1
FAS Chr10:90770494 c.506-16A>G NM_000043.4
FASLG Chr1:172628081 c.-261T>C NM_000639.1
GATA1 ChrX:48649496 c.-19-2A>G NM_002049.3
GATA2 Chr3:128202131 c.1017+572C>T NM_032638.4
GATA2 Chr3:128202162 c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC NM_032638.4
GATA2 Chr3:128202171 c.1017+532T>A NM_032638.4
GINS1 Chr20:25388397 c.-60A>G NM_021067.3
GINS1 Chr20:25388409 c.-48C>G NM_021067.3
HPS3 Chr3:148888270 c.2888-1612G>A NM_032383.3 rs281865096
ITGA2B Chr17:42449567 c.*165T>C NM_000419.3
ITGA2B Chr17:42455177 c.2095-19T>A NM_000419.3
ITGA2B Chr17:42458507 c.1211-78A>G NM_000419.3
ITGA2B Chr17:42463181 c.408+11C>A NM_000419.3
ITGA2B Chr17:42470923 c.-4082G>A NM_000419.3
LAMTOR2 Chr1:156028185 c.*23C>A NM_014017.3
MLH1 Chr3:37034619 c.-413_-411delGAG NM_000249.3 rs953169437
MLH1 Chr3:37034932 c.-107C>G NM_000249.3 rs587778886
MLH1 Chr3:37034976 c.-63_-58delGTGATTinsCACGAGGCACGAGCACGA NM_000249.3
MLH1 Chr3:37034997 c.-42C>T NM_000249.3 rs41285097
MLH1 Chr3:37035012 c.-27C>A NM_000249.3 rs587779001
MLH1 Chr3:37035260 c.116+106G>A NM_000249.3
MLH1 Chr3:37038099 c.117-11T>A NM_000249.3 rs267607711
MLH1 Chr3:37050292 c.454-13A>G NM_000249.3 rs267607749
MLH1 Chr3:37061788 c.885-9_887dupTCCTGACAGTTT NM_000249.3 rs63751620
MLH1 Chr3:37070436 c.1558+13T>A NM_000249.3 rs267607834
MSH2 Chr2:47630106 c.-225G>C NM_000251.2 rs138068023
MSH2 Chr2:47630150 c.-181G>A NM_000251.2 rs786201698
MSH2 Chr2:47630249 c.-81dupA NM_000251.2 rs560991330,rs587779187
MSH2 Chr2:47630251 c.-78_-77delTG NM_000251.2 rs587779182
MSH2 Chr2:47698086 c.1662-17dupG NM_000251.2 rs587779099
MSH6 Chr2:48018295 c.457+33_457+34insGTGT NM_000179.2
MSH6 Chr2:48030536 c.3173-16_3173-5delCCCTCTCTTTTA NM_000179.2
MSH6 Chr2:48034014 c.*15A>C NM_000179.2
MSH6 Chr2:48034047 c.*49_*68dupTTCAGACAACATTATGATCT NM_000179.2 rs777409019
NF1 Chr17:29422055 c.-273A>C NM_001042492.2
NF1 Chr17:29422056 c.-272G>A NM_001042492.2
NF1 Chr17:29431417 c.60+9031_60+9035delAAGTT NM_001042492.2
NF1 Chr17:29475515 c.61-7486G>T NM_001042492.2
NF1 Chr17:29488136 c.288+2025T>G NM_001042492.2
NF1 Chr17:29508426 c.587-14T>A NM_001042492.2
NF1 Chr17:29508428 c.587-12T>A NM_001042492.2
NF1 Chr17:29510334 c.888+651T>A NM_001042492.2
NF1 Chr17:29510427 c.888+744A>G NM_001042492.2
NF1 Chr17:29510472 c.888+789A>G NM_001042492.2
NF1 Chr17:29527428 c.889-12T>A NM_001042492.2
NF1 Chr17:29530107 c.1260+1604A>G NM_001042492.2
NF1 Chr17:29533239 c.1261-19G>A NM_001042492.2
NF1 Chr17:29534143 c.1392+754T>G NM_001042492.2
NF1 Chr17:29540877 c.1393-592A>G NM_001042492.2
NF1 Chr17:29542762 c.1527+1159C>T NM_001042492.2
NF1 Chr17:29548419 c.1642-449A>G NM_001042492.2 rs863224655
NF1 Chr17:29549489 c.*481A>G NM_001128147.2
NF1 Chr17:29553439 c.2002-14C>G NM_001042492.2
NF1 Chr17:29554225 c.2252-11T>G NM_001042492.2
NF1 Chr17:29556025 c.2410-18C>G NM_001042492.2
NF1 Chr17:29556027 c.2410-16A>G NM_001042492.2
NF1 Chr17:29556028 c.2410-15A>G NM_001042492.2
NF1 Chr17:29556031 c.2410-12T>G NM_001042492.2
NF1 Chr17:29556839 c.2851-14_2851-13insA NM_001042492.2
NF1 Chr17:29557267 c.2991-11T>G NM_001042492.2
NF1 Chr17:29563299 c.3974+260T>G NM_001042492.2
NF1 Chr17:29577082 c.4110+945A>G NM_001042492.2
NF1 Chr17:29580296 c.4173+278A>G NM_001042492.2
NF1 Chr17:29588708 c.4578-20_4578-18delAAG NM_001042492.2
NF1 Chr17:29588715 c.4578-14T>G NM_001042492.2
NF1 Chr17:29654479 c.5269-38A>G NM_001042492.2
NF1 Chr17:29656858 c.5610-456G>T NM_001042492.2
NF1 Chr17:29657848 c.5812+332A>G NM_001042492.2 rs863224491
NF1 Chr17:29661577 c.5813-279A>G NM_001042492.2
NF1 Chr17:29664375 c.6428-11T>G NM_001042492.2
NF1 Chr17:29664618 c.6642+18A>G NM_001042492.2
NF1 Chr17:29676126 c.7190-12T>A NM_001042492.2
NF1 Chr17:29676127 c.7190-11_7190-10insGTTT NM_001042492.2
NF1 Chr17:29685177 c.7971-321C>G NM_001042492.2
NF1 Chr17:29685481 c.7971-17C>G NM_001042492.2
NF1 Chr17:29685665 c.8113+25A>T NM_001042492.2
PALB2 Chr16:23649285 c.109-12T>A NM_024675.3 rs774949203
PARN Chr16:14724045 c.-165+2C>T NM_001134477.2
PMS2 Chr7:6027263 c.1145-31_1145-13delCTGACCCTCTTCTCCGTCC NM_000535.5 rs751973268
PMS2 Chr7:6048599 c.23+21_23+28delTCCGGTGT NM_000535.5
PTPN11 Chr12:112915602 c.934-59T>A NM_002834.3
RBM8A Chr1:145507646 c.-21G>A NM_005105.4
RBM8A Chr1:145507765 c.67+32G>C NM_005105.4 rs201779890
RPL31 Chr2:101618778 c.-1+1G>A NM_001098577.2
RPL5 Chr1:93300322 c.190-12_191dupCTCTTACTATAGAT NM_000969.3
RPS19 Chr19:42364214 c.-144_-141delTTTC NM_001022.3
RPS26 Chr12:56436176 c.4-25_4-14delTAACAGTTTTCC NM_001029.3
RPS7 Chr2:3622941 c.-19+1G>T NM_001011.3
RPS7 Chr2:3622942 c.-19+2T>C NM_001011.3
SEC23B Chr20:18488060 c.-571A>G NM_006363.4 rs559854357
SEC23B Chr20:18488615 c.-16A>G NM_006363.4
SEC23B Chr20:18491731 c.221+31A>G NM_006363.4
SEC23B Chr20:18491863 c.221+163A>G NM_006363.4 rs573898514
SEC23B Chr20:18492791 c.222-78C>T NM_006363.4 rs150393520
SEC23B Chr20:18526845 c.1743+168A>G NM_006363.4 rs111951711
SH2D1A ChrX:123499593 c.138-17_138-11delAGTTTAT NM_002351.4
STX11 Chr6:144508713 c.*85_*86insT NM_003764.3
STXBP2 Chr19:7705761 c.326-23_326-16delGCCCCACT NM_006949.3
TERC Chr3:169482870 n.-22C>T NR_001566.1
TERC Chr3:169482906 NR_001566.1
TERC Chr3:169482948 n.-100C>G NR_001566.1 rs199422256
TERC Chr3:169483086 NR_001566.1 rs199422255
TERT Chr5:1271334 c.2383-15C>T NM_198253.2 rs574645600
TERT Chr5:1295161 c.-57A>C NM_198253.2
TP53 Chr17:7571520 NM_000546.5
TP53 Chr17:7577647 c.673-39G>A NM_000546.5
TP53 Chr17:7579601 c.97-11C>G NM_000546.5
TP53 Chr17:7590694 c.-29+1G>T NM_000546.5
UNC13D Chr17:73826245 c.2831-13G>A NM_199242.2
UNC13D Chr17:73827442 c.2448-13G>A NM_199242.2 rs753762300
UNC13D Chr17:73839907 c.118-307G>A NM_199242.2
UNC13D Chr17:73839908 c.118-308C>T NM_199242.2
WAS ChrX:48547690 c.1339-19_1339-11delTGATCCCTGinsATCTGCAGACC NM_000377.2

Test Strengths

The strengths of this test include:

  • CAP accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: CSF2RA NM_001161530.2:11, PGM3 NM_001199919.2:14, PMS2 NM_000535.7:13-15, RPL15 NM_001253384.2:5, VPS45 NM_001279353.2:13. Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene's target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:

  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:

  • Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments
  • Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section.

The genes on the panels have been carefully selected based on scientific literature, mutation databases and our experience.

The panels are sectioned from our high-quality, clinical grade NGS assay. The panel analysis is a combination of both sequence variants (SNVs and indels) as well as deletions and duplications (copy number variants (CNV)).

Please refer to the table below for performance metrics of the analytical validation of the assay. The validation includes the evaluation of reference samples to determine the capability of the assay to detect various types of variants. The sensitivity values quoted in the analytic validation may not precisely reflect the performance in a production setting and is not a guarantee of the assay’s clinical performance. The provided performance metrics are based on a validation conducted at our laboratory in Finland. The assay has been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva, and dried blood spots (filter cards).

Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Analytical sensitivity to detect single-nucleotide variants and indels were calculated using both versions v3.3.2 and v4.2.1 of high-confidence region benchmark data provided by Genome in a Bottle (GIAB) consortium. Version 4.2.1 is extended to include challenging medically relevant regions and other difficult to map regions. Version 4.2.1 covers 94.1% of reference (GRCh37) and v3.3.2 covers 87.8% of reference. For more information, see GIAB publication https://doi.org/10.1016/j.xgen.2022.100128.

Sensitivity % (TP/(TP+FN) Specificity %
GIAB Version 3.3.2 GIAB Version 4.2.1 GIAB Version 3.3.2 GIAB Version 4.2.1
Single nucleotide variants 99.57 % 97.58 % 100 % 100 %
Insertions, deletions
1-10 bps 95.38 % 95.13 % 100.00 % 100.00 %
11-20 bps 99.09 % 98.15 % 100.00 % 100.00 %
21-50 bps 98.78 % 98.85 % 100.00 % 100.00 %
2-50 bps 97.62 % 97.41 % 100.00 % 100.00 %
Copy number variants (exon level dels/dups, clinical sample performance) Sensitivity Specificity
1 exon level deletion (heterozygous) 100% (14/14) NA
1 exon deletion (homozygous or hemizygous) 100% (5/5) NA
2-4 exon deletion (heterozygous or homozygous) 100% (17/17) NA
5-33 exon deletion (heterozygous) 100% (12/12) NA
1-5 exon duplication (heterozygous or homozygous) 77% (10/13) NA
9-31 exon duplication (heterozygous) 100% (7/7) NA
Simulated CNV detection in reference samples (n=10) Sensitivity
5 exon level deletion/duplication 98 %
Microdeletion/-duplication syndromes (large CNVs, n=22))
Size range (0.1-47 Mb) 100% (22/22)
         
The performance presented above was reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics
Average of median sequencing depths in reference samples 136x
Nucleotides with >20x sequencing coverage (%) 99.77%


Performance of Blueprint Genetics Mitochondrial Sequencing Assay.

ANALYTIC VALIDATION (reference samples; n=4) Sensitivity %      
Single nucleotide variants
Heteroplasmic (45-100%) 100.0% (50/50)
Heteroplasmic (35-45%) 100.0% (87/87)
Heteroplasmic (25-35%) 100.0% (73/73)
Heteroplasmic (15-25%) 100.0% (74/74)
Heteroplasmic (5-15%) 100.0% (79/79)
Heteroplasmic (<5%) 53.3 % (8/15)
CLINICAL VALIDATION (n=20 samples)
Single nucleotide variants (n=18 SNVs) 100.0% (3/3)
Heteroplasmic (10-15%) 100.0% (5/5)
Heteroplasmic (5-10%) 100.0% (5/5)
Heteroplasmic (<5%) 20% (1/5)
Insertions and deletions by sequence analysis (n=3)
Heteroplasmic (45-100%) 1-10bp 100.0% (3/3)
Validation of the mitochondrial genome analysis workflow (based on simulated data of pathogenic mitomap mutations)
Insertions and deletions 1-24 bps by sequence analysis; n=17
Homoplasmic (100%) 1-24bp 100.0% (17/17)
Heteroplasmic (50%) 100.0% (17/17)
Heteroplasmic (25%) 100.0% (17/17)
Heteroplasmic (20%) 100.0% (17/17)
Heteroplasmic (15%) 100.0% (17/17)
Heteroplasmic (10%) 94.1% (16/17)
Heteroplasmic (5%) 94.1% (16/17)
Copy number variants (separate artifical mutations; n=1500)
Homoplasmic (100%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (50%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (30%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (20%) 500 bp, 1kb, 5 kb 99.7%
Heteroplasmic (10%) 500 bp, 1kb, 5 kb 99.0%
Following mtDNA coverage metrics were obtained in clinical samples in the assay validation (n=238)
Mean of medians
Mean sequencing depth MQ0 6334x
Nucleotides with >1000x MQ0 sequencing coverage (%) 100%
rho zero cell line (=no mtDNA), mean sequencing depth in mitochondrial assay validation 12X

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. If the test includes the mitochondrial genome the target region gene list contains the mitochondrial genes. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as  SIFT, PolyPhen,MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with suboptimal coverage (<20X for nuclear genes and <1000X for mtDNA) if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

We provide customers with comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our Ph.D. molecular geneticists, medical professionals, and other highly experienced experts prepare clinical reports by evaluating the identified variants in the context of the phenotypic information provided in the requisition form.

Our goal is to provide clinically meaningful reports that are understandable for all medical professionals regardless of whether they have formal training in genetics. Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015. Sequence and copy number variants classified as pathogenic, likely pathogenic, and variants of uncertain significance (VUS) are confirmed using bidirectional Sanger sequencing or by orthogonal methods such as qPCR/ddPCR when they do not meet our stringent NGS quality metrics for a true positive call.

Our clinical report includes tables for sequence and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, phenotypes, and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene, and phenotype(s), including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts, and detailed information about related phenotypes. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired.

The panel report is divided into primary findings and additional findings sections. Variants reported as primary findings are known disease-causing variants or rare variants that could potentially explain the patient’s phenotype as described to the laboratory at the time of interpretation. The conclusion summarizes all the existing information and provides our rationale for the classification of the variant.

Variants reported as additional findings are variants that are not likely or sufficient to cause the tested patient’s phenotype, based on the current knowledge. Additional findings in panel reports include variants that are, for example, carrierships of single heterozygous variants in genes associated with autosomal recessive disorders, variants of uncertain significance in genes associated with autosomal dominant disorders (if pathogenic or likely pathogenic variants considered sufficient to explain the patient’s phenotype are reported as primary findings), or risk alleles identified in genes included in the panel.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well positioned to reclassify previously reported variants as new information becomes available. If a variant previously reported as a primary or secondary finding by Blueprint Genetics is reclassified so that it becomes diagnostic (VUS to P/LP) or earlier molecular diagnosis is removed (P/LP to VUS, LB, B), our laboratory will issue a follow-up statement to the original ordering healthcare provider at no additional cost.