Osteogenesis Imperfecta Panel

Summary
Is a 33 gene panel that includes assessment of non-coding variants.

Is ideal for patients with a clinical suspicion of osteogenesis imperfecta. The genes on this panel are included in the Comprehensive Growth Disorders / Skeletal Dysplasias and Disorders Panel.

Analysis methods
  • PLUS
Availability
4 weeks
Number of genes
33
Test code
MA3001
Panel tier
Tier 4
* The CPT codes provided are based on AMA guidelines and are for informational purposes only. CPT coding is the sole responsibility of the billing party. Please direct any questions regarding coding to the payer being billed.

Summary

The Blueprint Genetics Osteogenesis Imperfecta Panel (test code MA3001):

Read about our accreditations, certifications and CE-marked IVD medical devices here.

ICD Codes

Refer to the most current version of ICD-10-CM manual for a complete list of ICD-10 codes.

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Please see Sample Requirements for accepted saliva kits)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.

Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.

Read more about our sample requirements here.

Osteogenesis imperfecta (OI) phenotype is variable, ranging from osteoporosis presenting in adulthood to lethality in infancy. The two mildest forms, classic non-deforming OI and common variable OI, account for considerably more than half of all OI. About 90% of patients have mutations in type I collagen genes (COL1A1 and COL1A2). COL1A1/2-related OI is inherited in an autosomal dominant manner. Several additional genes have recently been identified. The primary differential diagnosis for individuals with features of COL1A1/2-related OI are autosomal recessive subtypes of OI. The proportion of cases caused by a de novo COL1A1 or COL1A2 mutation varies by the severity of disease: approximately 60% of cases of classic non-deforming OI with blue sclerae or common variable OI with normal sclerae, virtually 100% of perinatally lethal OI, and close to 100% of progressively deforming OI are de novo. Gonadal mosaicism may be present in 3%-5% of cases. Disease prevalence is approximately 6-7:100,000. The major clinical manifestation is skeletal fragility. Skeletal deformity, short stature, scoliosis and wormian bones may be present. Other extraskeletal manifestations may include hearing loss, dentinogenesis imperfecta, blue/gray sclerae, hypercalciuria, easy bruisability, increased laxity of the ligaments and skin and cardiovascular abnormalities. The differential diagnosis includes child abuse, rickets, osteomalacia, and other rare skeletal syndromes. We have included genes for hypophosphatasia on this panel for differential diagnostic purposes. We have also included genes for some syndromes/disorders where osteopenia/fractures is one of the findings for differential diagnostic purposes for cases with limited clinical information, such as newborns.

Genes in the Osteogenesis Imperfecta Panel and their clinical significance

To view complete table content, scroll horizontally.

Gene Associated phenotypes Inheritance ClinVar HGMD
ALPL Odontohypophosphatasia, Hypophosphatasia perinatal lethal, infantile, juvenile and adult forms AD/AR 78 291
ARCN1 Rhizomelic short stature with microcephaly, micrognathia, and developmental delay (SRMMD) AD 3 3
B3GAT3#* Multiple joint dislocations, short stature, craniofacial dysmorphism, and congenital heart defects AR 6 13
B4GALT7 Ehlers-Danlos syndrome, progeroid form AR 8 9
BMP1 Osteogenesis imperfecta AR 7 21
CLCN5 Proteinuria, low molecular weight, with hypercalciuric nephrocalcinosis, Hypophosphatemic rickets,, Nephrolithiasis, I, Dent disease XL 48 272
COL1A1 Ehlers-Danlos syndrome, Caffey disease, Osteogenesis imperfecta type 1, Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, Osteogenesis imperfecta type 4 AD 352 962
COL1A2 Ehlers-Danlos syndrome, cardiac valvular form, Osteogenesis imperfecta type 1, Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, Osteogenesis imperfecta type 4 AD/AR 186 509
CREB3L1 Osteogenesis imperfecta, type XVI AR 2 3
CRTAP Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, Osteogenesis imperfecta type 4 AR 12 30
FAM46A Osteogenesis imperfecta AR 3 3
FGF23 Tumoral calcinosis, hyperphosphatemic, Hypophosphatemic rickets AD/AR 10 17
FKBP10 Bruck syndrome 1, Osteogenesis imperfecta, type XI AR 20 44
IFITM5 Osteogenesis imperfecta type 5 AD 2 2
LRP5* Van Buchem disease, Osteoporosis-pseudoglioma syndrome, Hyperostosis, endosteal, Osteosclerosis, Exudative vitreoretinopathy, Osteopetrosis late-onset form type 1, LRP5 primary osteoporosis AD/AR/Digenic 57 196
MBTPS2 Keratosis follicularis spinulosa decalvans, IFAP syndrome, Palmoplantar keratoderma, mutilating, with periorificial keratotic plaques XL 12 25
P3H1 Osteogenesis imperfecta AR 18 63
P4HB Cole Carpenter syndrome 1 AD 1 11
PHEX Hypophosphatemic rickets XL 263 437
PLOD2 Bruck syndrome, Osteogenesis imperfecta type 3 AR 8 23
PLS3 Osteoporosis and osteoporotic fractures XL 1 17
PPIB Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, Osteogenesis imperfecta type 4 AR 8 13
SEC24D Cole-Carpenter syndrome 2 AR 4 12
SERPINF1 Osteogenesis imperfecta, type VI AR 9 41
SERPINH1 Osteogenesis imperfecta type 3 AR 3 6
SGMS2 Osteoporosis and osteoporotic fractures, Skeletal dysplasia and disorders AD
SLC29A3 Histiocytosis-lymphadenopathy plus syndrome, Dysosteosclerosis AR 17 25
SLC34A3 Hypophosphatemic rickets with hypercalciuria AR 22 38
SP7 Osteogenesis imperfecta, type XII AR 2 3
SPARC Keratoconus, Osteogenesis imperfecta, type XVII AR 2 4
TAPT1 2 3
TMEM38B Osteogenesis imperfecta, type XIV AR 2 7
WNT1 Osteoprosis, autosomal dominant, Osteogenesis imperfecta, type XV AD/AR 9 40
#

The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.

*

Some, or all, of the gene is duplicated in the genome. Read more.

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.

Non-coding variants covered by Osteogenesis Imperfecta Panel

To view complete table content, scroll horizontally.

Gene Genomic location HG19 HGVS RefSeq RS-number Comment Reference
ALPL Chr1:21835920 c.-195C>T NM_000478.4
ALPL Chr1:21896764 c.793-30_793-11delGGCATGTGCTGACACAGCCC NM_000478.4
BMP1 Chr8:22058957 c.*241T>C NM_001199.3 rs786205217
COL1A1 Chr17:48266910 c.2668-11T>G NM_000088.3 rs786205505
COL1A1 Chr17:48267594 c.2451+94G>T NM_000088.3
COL1A1 Chr17:48267611 c.2451+77C>T NM_000088.3 rs72651665
COL1A1 Chr17:48268147 c.2343+31T>A NM_000088.3
COL1A1 Chr17:48272201 c.1354-12G>A NM_000088.3 rs72648337
COL1A1 Chr17:48273368 c.1003-43_1003-32delTGCCATCTCTTC NM_000088.3 rs72645359
COL1A1 Chr17:48273574 c.958-18_958-15delTTCC NM_000088.3 rs72645351
COL1A1 Chr17:48273742 c.904-14G>A NM_000088.3
COL1A1 Chr17:48273743 c.904-15T>A NM_000088.3
COL1A2 Chr7:94025130 c.70+717A>G NM_000089.3 rs72656354
COL1A2 Chr7:94030856 c.226-22_226-11delTTTTTTTTTTTT NM_000089.3
CRTAP Chr3:33160815 c.472-1021C>G NM_006371.4 rs72659360
IFITM5 Chr11:299504 c.-14C>T NM_001025295.2 rs587776916 Explain almost all cases of OI type V PMID 23240094
PHEX ChrX:22076478 c.349+11149A>T NM_000444.4
PHEX ChrX:22113485 c.849+1268G>T NM_000444.4
PHEX ChrX:22237137 c.1701-16T>A NM_000444.4
PHEX ChrX:22237393 c.1768+177_1768+180dupGTAA NM_000444.4
PHEX ChrX:22266301 c.*231A>G NM_000444.4
PLS3 ChrX:114856534 c.74-24T>A NM_005032.5
SERPINF1 Chr17:1665408 c.-9+2dupT NM_002615.5 rs398122519
SERPINF1 Chr17:1674512 c.439+34C>T NM_002615.5
SERPINF1 Chr17:1675121 c.440-40_440-38delTCG NM_002615.5 rs775552455
SERPINF1 Chr17:1679209 c.787-617G>A NM_002615.5
SLC29A3 Chr10:73122778 c.*413G>A NM_018344.5

Test Strengths

The strengths of this test include:

  • CAP accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: B3GAT3 NM_001288722.2:5. Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene's target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:

  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:

  • Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments
  • Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section.

The genes on the panels have been carefully selected based on scientific literature, mutation databases and our experience.

The panels are sectioned from our high-quality, clinical grade NGS assay. The panel analysis is a combination of both sequence variants (SNVs and indels) as well as deletions and duplications (copy number variants (CNV)).

Please refer to the table below for performance metrics of the analytical validation of the assay. The validation includes the evaluation of reference samples to determine the capability of the assay to detect various types of variants. The sensitivity values quoted in the analytic validation may not precisely reflect the performance in a production setting and is not a guarantee of the assay’s clinical performance. The provided performance metrics are based on a validation conducted at our laboratory in Finland. The assay has been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva, and dried blood spots (filter cards).

Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Analytical sensitivity to detect single-nucleotide variants and indels were calculated using both versions v3.3.2 and v4.2.1 of high-confidence region benchmark data provided by Genome in a Bottle (GIAB) consortium. Version 4.2.1 is extended to include challenging medically relevant regions and other difficult to map regions. Version 4.2.1 covers 94.1% of reference (GRCh37) and v3.3.2 covers 87.8% of reference. For more information, see GIAB publication https://doi.org/10.1016/j.xgen.2022.100128.

Sensitivity % (TP/(TP+FN) Specificity %
GIAB Version 3.3.2 GIAB Version 4.2.1 GIAB Version 3.3.2 GIAB Version 4.2.1
Single nucleotide variants 99.57 % 97.58 % 100 % 100 %
Insertions, deletions
1-10 bps 95.38 % 95.13 % 100.00 % 100.00 %
11-20 bps 99.09 % 98.15 % 100.00 % 100.00 %
21-50 bps 98.78 % 98.85 % 100.00 % 100.00 %
2-50 bps 97.62 % 97.41 % 100.00 % 100.00 %
Copy number variants (exon level dels/dups, clinical sample performance) Sensitivity Specificity
1 exon level deletion (heterozygous) 100% (14/14) NA
1 exon deletion (homozygous or hemizygous) 100% (5/5) NA
2-4 exon deletion (heterozygous or homozygous) 100% (17/17) NA
5-33 exon deletion (heterozygous) 100% (12/12) NA
1-5 exon duplication (heterozygous or homozygous) 77% (10/13) NA
9-31 exon duplication (heterozygous) 100% (7/7) NA
Simulated CNV detection in reference samples (n=10) Sensitivity
5 exon level deletion/duplication 98 %
Microdeletion/-duplication syndromes (large CNVs, n=22))
Size range (0.1-47 Mb) 100% (22/22)
         
The performance presented above was reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics
Average of median sequencing depths in reference samples 136x
Nucleotides with >20x sequencing coverage (%) 99.77%


Performance of Blueprint Genetics Mitochondrial Sequencing Assay.

ANALYTIC VALIDATION (reference samples; n=4) Sensitivity %      
Single nucleotide variants
Heteroplasmic (45-100%) 100.0% (50/50)
Heteroplasmic (35-45%) 100.0% (87/87)
Heteroplasmic (25-35%) 100.0% (73/73)
Heteroplasmic (15-25%) 100.0% (74/74)
Heteroplasmic (5-15%) 100.0% (79/79)
Heteroplasmic (<5%) 53.3 % (8/15)
CLINICAL VALIDATION (n=20 samples)
Single nucleotide variants (n=18 SNVs) 100.0% (3/3)
Heteroplasmic (10-15%) 100.0% (5/5)
Heteroplasmic (5-10%) 100.0% (5/5)
Heteroplasmic (<5%) 20% (1/5)
Insertions and deletions by sequence analysis (n=3)
Heteroplasmic (45-100%) 1-10bp 100.0% (3/3)
Validation of the mitochondrial genome analysis workflow (based on simulated data of pathogenic mitomap mutations)
Insertions and deletions 1-24 bps by sequence analysis; n=17
Homoplasmic (100%) 1-24bp 100.0% (17/17)
Heteroplasmic (50%) 100.0% (17/17)
Heteroplasmic (25%) 100.0% (17/17)
Heteroplasmic (20%) 100.0% (17/17)
Heteroplasmic (15%) 100.0% (17/17)
Heteroplasmic (10%) 94.1% (16/17)
Heteroplasmic (5%) 94.1% (16/17)
Copy number variants (separate artifical mutations; n=1500)
Homoplasmic (100%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (50%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (30%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (20%) 500 bp, 1kb, 5 kb 99.7%
Heteroplasmic (10%) 500 bp, 1kb, 5 kb 99.0%
Following mtDNA coverage metrics were obtained in clinical samples in the assay validation (n=238)
Mean of medians
Mean sequencing depth MQ0 6334x
Nucleotides with >1000x MQ0 sequencing coverage (%) 100%
rho zero cell line (=no mtDNA), mean sequencing depth in mitochondrial assay validation 12X

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. If the test includes the mitochondrial genome the target region gene list contains the mitochondrial genes. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as  SIFT, PolyPhen,MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with suboptimal coverage (<20X for nuclear genes and <1000X for mtDNA) if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

We provide customers with comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our Ph.D. molecular geneticists, medical professionals, and other highly experienced experts prepare clinical reports by evaluating the identified variants in the context of the phenotypic information provided in the requisition form.

Our goal is to provide clinically meaningful reports that are understandable for all medical professionals regardless of whether they have formal training in genetics. Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015. Sequence and copy number variants classified as pathogenic, likely pathogenic, and variants of uncertain significance (VUS) are confirmed using bidirectional Sanger sequencing or by orthogonal methods such as qPCR/ddPCR when they do not meet our stringent NGS quality metrics for a true positive call.

Our clinical report includes tables for sequence and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, phenotypes, and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene, and phenotype(s), including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts, and detailed information about related phenotypes. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired.

The panel report is divided into primary findings and additional findings sections. Variants reported as primary findings are known disease-causing variants or rare variants that could potentially explain the patient’s phenotype as described to the laboratory at the time of interpretation. The conclusion summarizes all the existing information and provides our rationale for the classification of the variant.

Variants reported as additional findings are variants that are not likely or sufficient to cause the tested patient’s phenotype, based on the current knowledge. Additional findings in panel reports include variants that are, for example, carrierships of single heterozygous variants in genes associated with autosomal recessive disorders, variants of uncertain significance in genes associated with autosomal dominant disorders (if pathogenic or likely pathogenic variants considered sufficient to explain the patient’s phenotype are reported as primary findings), or risk alleles identified in genes included in the panel.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well positioned to reclassify previously reported variants as new information becomes available. If a variant previously reported as a primary or secondary finding by Blueprint Genetics is reclassified so that it becomes diagnostic (VUS to P/LP) or earlier molecular diagnosis is removed (P/LP to VUS, LB, B), our laboratory will issue a follow-up statement to the original ordering healthcare provider at no additional cost.