Skeletal Dysplasias Core Panel

Summary
Is a 113 gene panel that includes assessment of non-coding variants.

Is ideal for patients with a clinical suspicion of a skeletal dysplasia. The genes on this panel are included in the Comprehensive Skeletal Dysplasias and Disorders Panel and in the Comprehensive Growth Disorders / Skeletal Dysplasias and Disorders Panel.

Analysis methods
  • PLUS
Availability
4 weeks
Number of genes
113
Test code
MA3501
Panel tier
Tier 4
* The CPT codes provided are based on AMA guidelines and are for informational purposes only. CPT coding is the sole responsibility of the billing party. Please direct any questions regarding coding to the payer being billed.

Summary

The Blueprint Genetics Skeletal Dysplasias Core Panel (test code MA3501):

Read about our accreditations, certifications and CE-marked IVD medical devices here.

This panel includes also a pathogenic intronic variant that is often missed by exome sequencing: IFITM5 c.-14C>T (rs587776916), which accounts for almost all cases of osteogenesis imperfecta type V (PMID 23240094). Currently, other regions of IFITM5 gene are not yet covered.

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Please see Sample Requirements for accepted saliva kits)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.

Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.

Read more about our sample requirements here.

The Skeletal Dysplasias Core Panel is designed to detect mutations responsible for various skeletal dysplasias. Some of the resulting skeletal dysplasias are severe and potentially lethal (such as thanatophoric dysplasia, different types of achondrogenesis and osteogenesis imperfecta type II). Other non-lethal skeletal dysplasias result in disproportionate short stature. Achondroplasia is the most common cause of disproportionate short stature worldwide. It is characterized by rhizomelic shortening of the limbs, exaggerated lumbar lordosis, brachydactyly, and macrocephaly with frontal bossing and midface hypoplasia. Type II collagen defects (mutations in COL2A1 genes) have been identified in a spectrum of disorders ranging from perinatally lethal conditions to those with only mild arthropathy. As many different skeletal dysplasias have similar clinical and radiological findings, multigene panel testing allows for efficient diagnostic testing. Identification of causative mutation(s) establishes the inheritance mode in the family and enables genetic counselling. In addition, identifying the causative mutation(s) provides essential information for the doctor taking care of the patient. This panel provides excellent diffential diagnostic power for the major genes causing skeletal dysplasias.

Genes in the Skeletal Dysplasias Core Panel and their clinical significance

To view complete table content, scroll horizontally.

Gene Associated phenotypes Inheritance ClinVar HGMD
ACAN# Spondyloepimetaphyseal dysplasia, aggrecan type, Spondyloepiphyseal dysplasia, Kimberley type, Osteochondritis dissecans, short stature, and early-onset osteoarthritis AD/AR 20 56
ACP5 Spondyloenchondrodysplasia with immune dysregulation AR 12 26
ADAMTS10 Weill-Marchesani syndrome AR 8 14
ADAMTSL2#* Geleophysic dysplasia 3 AR 8 28
AGPS Rhizomelic chondrodysplasia punctata type 3 AR 4 8
ALPL Odontohypophosphatasia, Hypophosphatasia perinatal lethal, infantile, juvenile and adult forms AD/AR 78 291
ANKH Calcium pyrophosphate deposition disease (familial chondrocalcinosis type 2), Craniometaphyseal dysplasia autosomal dominant type AD 13 20
ARSE* Chondrodysplasia punctata X-linked recessive, brachytelephalangic type (CDPX1) XL 22 46
B3GALT6 Spondyloepimetaphyseal dysplasia with joint laxity, Ehlers-Danlos syndrome AR 17 27
BMP1 Osteogenesis imperfecta AR 7 21
BMPR1B Acromesomelic dysplasia, Demirhan, Brachydactyly C/Symphalangism-like pheno, Brachydactyly type A2, Pulmonary arterial hypertension (PAH) AD/AR 12 23
CA2 Osteopetrosis, with renal tubular acidosis AR 9 31
CANT1 Desbuquois dysplasia AR 20 28
CDC6 Meier-Gorlin syndrome (Ear-patella-short stature syndrome) AR 2 2
CDKN1C Beckwith-Wiedemann syndrome, IMAGE syndrome AD 35 81
CDT1 Meier-Gorlin syndrome (Ear-patella-short stature syndrome) AR 6 12
CHST3 Spondyloepiphyseal dysplasia with congenital joint dislocations (recessive Larsen syndrome) AR 18 37
CLCN7 Osteopetrosis AD/AR 15 98
COL10A1 Metaphyseal chondrodysplasia, Schmid AD 21 53
COL11A1 Marshall syndrome, Fibrochondrogenesis, Stickler syndrome type 2 AD/AR 34 94
COL11A2 Weissenbacher-Zweymuller syndrome, Deafness, Otospondylomegaepiphyseal dysplasia, Fibrochondrogenesis, Stickler syndrome type 3 (non-ocular) AD/AR 29 57
COL1A1 Ehlers-Danlos syndrome, Caffey disease, Osteogenesis imperfecta type 1, Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, Osteogenesis imperfecta type 4 AD 352 962
COL1A2 Ehlers-Danlos syndrome, cardiac valvular form, Osteogenesis imperfecta type 1, Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, Osteogenesis imperfecta type 4 AD/AR 186 509
COL2A1 Avascular necrosis of femoral head, Rhegmatogenous retinal detachment, Epiphyseal dysplasia, with myopia and deafness, Czech dysplasia, Achondrogenesis type 2, Platyspondylic dysplasia Torrance type, Hypochondrogenesis, Spondyloepiphyseal dysplasia congenital (SEDC), Spondyloepimetaphyseal dysplasia (SEMD) Strudwick type, Kniest dysplasia, Spondyloperipheral dysplasia, Mild SED with premature onset arthrosis, SED with metatarsal shortening, Stickler syndrome type 1 AD 180 561
COL9A1 Stickler syndrome recessive type, Multiple epiphyseal dysplasia type 6 (EDM6) AD/AR 9 6
COL9A2 Stickler syndrome, Multiple epiphyseal dysplasia type 2 (EDM2) AD/AR 7 12
COL9A3 Multiple epihyseal dysplasia type 3 (EDM3), Stickler syndrome recessive type AD/AR 10 14
COMP Pseudoachondroplasia, Multiple ephiphyseal dysplasia AD 43 186
CRTAP Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, Osteogenesis imperfecta type 4 AR 12 30
CSPP1 Jeune asphyxiating thoracic dystrophy, Joubert syndrome AR 32 27
CTSK Pycnodysostosis AR 35 58
CUL7 3-M syndrome, Yakut short stature syndrome AR 26 83
CYP27B1 Vitamin D-dependent rickets AR 23 73
DHCR24 Desmosterolosis AR 6 9
DLL3 Spondylocostal dysostosis AR 12 26
DVL1 Robinow syndrome AD 17 19
DYM Dyggve-Melchior-Clausen dysplasia, Smith-McCort dysplasia AR 22 34
DYNC2H1 Short -rib thoracic dysplasia with or without polydactyly type 1, Short -rib thoracic dysplasia with or without polydactyly type 3, Asphyxiating thoracic dysplasia (ATD; Jeune), SRPS type 2 (Majewski) AR/Digenic 148 205
EBP Chondrodysplasia punctata, Male EBP disorder with neurologic defects (MEND) XL 43 90
EIF2AK3 SED, Wolcott-Rallison type AR 9 80
ENPP1 Arterial calcification, Hypophosphatemic rickets AD/AR 22 72
ESCO2 SC phocomelia syndrome, Roberts syndrome AR 30 31
EVC Weyers acrofacial dysostosis, Ellis-van Creveld syndrome AD/AR 58 83
EVC2 Ellis-van Creveld syndrome, Weyers acrodental dysostosis AD/AR 78 75
FAM20C Hypophosphatemia, hyperphosphaturia, dental anomalies, intracerebral calcifications and osteosclerosis (Raine syndrome) AR 13 25
FGF23 Tumoral calcinosis, hyperphosphatemic, Hypophosphatemic rickets AD/AR 10 17
FGFR1 Pfeiffer syndrome, Trigonocephaly, Hypogonadotropic hypogonadism, Osteoglophonic Dwarfism - Craniostenosis, Hartsfield syndrome AD/Digenic/Multigenic 72 257
FGFR2 Apert syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome, Lacrimoauriculodentodigital syndrome, Beare-Stevenson cutis gyrata syndrome, Antley-Bixler syndrome without genital anomalies or disordered steroidogenesis, Craniofacial-skeletal-dermatological dysplasia, Crouzon syndrome, Bent bone dysplasia AD 100 154
FGFR3 Lacrimoauriculodentodigital syndrome, Muenke syndrome, Crouzon syndrome with acanthosis nigricans, Camptodactyly, tall stature, and hearing loss (CATSHL) syndrome, Achondroplasia, Hypochondroplasia, Thanatophoric dysplasia type 1, Thanatophoric dysplasia type 2, SADDAN AD/AR 54 77
FKBP10 Bruck syndrome 1, Osteogenesis imperfecta, type XI AR 20 44
FLNA Frontometaphyseal dysplasia, Osteodysplasty Melnick-Needles, Otopalatodigital syndrome type 1, Otopalatodigital syndrome type 2, Terminal osseous dysplasia with pigmentary defects XL 133 257
FLNB Larsen syndrome (dominant), Atelosteogenesis type 1, Atelosteogenesis type 3, Spondylo-carpal-tarsal dyspasia, Boomerang dysplasia AD/AR 43 121
GDF5 Multiple synostoses syndrome, Fibular hypoplasia and complex brachydactyly, Acromesomelic dysplasia, Hunter-Thompson, Symphalangism, proximal, Chondrodysplasia, Brachydactyly type A2, Brachydactyly type C, Grebe dysplasia AD/AR 23 53
GNPAT Rhizomelic chondrodysplasia punctata, rhizomelic AR 8 14
HSPG2 Schwartz-Jampel syndrome, Dyssegmental dysplasia Silverman-Handmaker type, Dyssegmental dysplasia Rolland-Desbuquis type AD/AR 16 60
IFT140 Short -rib thoracic dysplasia with or without polydactyly, Asphyxiating thoracic dysplasia (ATD; Jeune) AR 38 63
IFT172 Retinitis pigmentosa, Short -rib thoracic dysplasia with or without polydactyly, Asphyxiating thoracic dysplasia (ATD; Jeune) AR 22 25
IFT80 Short -rib thoracic dysplasia with or without polydactyly, Asphyxiating thoracic dysplasia (ATD; Jeune) AR 11 11
IHH Acrocapitofemoral dysplasia, Brachydactyly, Syndactyly type Lueken AD/AR 12 32
INPPL1 Opsismodysplasia AR 16 32
KAT6B Ohdo syndrome, SBBYS variant, Genitopatellar syndrome AD 47 73
LBR Pelger-Huet anomaly, Reynolds syndrome, Greenberg/HEM skeletal dysplasia, Hydrops-ectopic calcification-moth-eaten skeletal dysplasia AD/AR 22 24
LIFR Stuve-Wiedemann dysplasia, Schwartz-Jampel type 2 syndrome AR 12 32
LMX1B Nail-patella syndrome AD 26 194
LRP5* Van Buchem disease, Osteoporosis-pseudoglioma syndrome, Hyperostosis, endosteal, Osteosclerosis, Exudative vitreoretinopathy, Osteopetrosis late-onset form type 1, LRP5 primary osteoporosis AD/AR/Digenic 57 196
LTBP2 Weill-Marchesani syndrome, Microspherophakia and/or megalocornea, with ectopia lentis and with or without secondary glaucoma, Glaucoma, primary congenital AR 21 27
MATN3 Spondyloepimetaphyseal dysplasia Matrilin type, Multiple epiphyseal dysplasia type 5 (EDM5) AD/AR 8 25
MMP9 Metaphyseal anadysplasia AR 1 7
MYO18B Klippel-Feil syndrome 4, autosomal recessive, with myopathy and facial dysmorphism AR 2 4
NEK1 Short -rib thoracic dysplasia with or without polydactyly, SRPS type 2 (Majewski) AR/Digenic 22 23
NPR2 Acromesomelic dysplasia type Maroteaux, Epiphyseal chondrodysplasia, Miura, Short stature with nonspecific skeletal abnormalities AD/AR 32 75
OBSL1 3-M syndrome AR 13 33
ORC1 Meier-Gorlin syndrome (Ear-patella-short stature syndrome) AR 9 10
ORC4 Meier-Gorlin syndrome (Ear-patella-short stature syndrome) AR 24 6
ORC6 Meier-Gorlin syndrome (Ear-patella-short stature syndrome) AR 7 6
P3H1 Osteogenesis imperfecta AR 18 63
PAPSS2 Brachyolmia 4 with mild epiphyseal and metaphyseal changes, SEMD PAPPS2 type AR 13 20
PCNT Microcephalic osteodysplastic primordial dwarfism AR 49 88
PEX7 Refsum disease, Rhizomelic CDP type 1 AR 44 53
PHEX Hypophosphatemic rickets XL 263 437
PISD AR
PLOD2 Bruck syndrome, Osteogenesis imperfecta type 3 AR 8 23
PLS3 Osteoporosis and osteoporotic fractures XL 1 17
PPIB Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, Osteogenesis imperfecta type 4 AR 8 13
PTH1R Metaphyseal chondrodysplasia Jansen type, Failure of tooth eruption, Eiken dysplasia, Blomstrand dysplasia AD/AR 13 43
RMRP Cartilage-hair hypoplasia, Metaphyseal dysplasia without hypotrichosis, Anauxetic dysplasia AR 87 123
RNU4ATAC Roifman syndrome, Microcephalic osteodysplastic primordial dwarfism type 1, Microcephalic osteodysplastic primordial dwarfism type 3 AR 15 24
ROR2 Robinow syndrome recessive type, Brachydactyly type B AD/AR 21 40
RUNX2 Cleidocranial dysplasia, Metaphyseal dysplasia with maxillary hypoplasia AD 21 216
SBDS* Aplastic anemia, Shwachman-Diamond syndrome, Severe spondylometaphyseal dysplasia AR 19 90
SERPINF1 Osteogenesis imperfecta, type VI AR 9 41
SERPINH1 Osteogenesis imperfecta type 3 AR 3 6
SHOX#* Leri-Weill dyschondrosteosis, Langer mesomelic dysplasia, Short stature XL/PAR 25 431
SLC26A2 Diastrophic dysplasia, Atelosteogenesis type 2, De la Chapelle dysplasia, Recessive Multiple Epiphyseal dysplasia, Achondrogenesis type 1B AR 73 54
SLC34A3 Hypophosphatemic rickets with hypercalciuria AR 22 38
SLC39A13 Spondylodysplastic Ehlers-Danlos syndrome AR 2 9
SMAD4 Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome, Polyposis, juvenile intestinal, Myhre dysplasia, Hereditary hemorrhagic telangiectasia AD 179 143
SMARCAL1 Schimke immunoosseous dysplasia AR 20 88
SOX9 Campomelic dysplasia, 46,XY sex reversal, Brachydactyly with anonychia (Cooks syndrome) AD 47 144
TCIRG1 Osteopetrosis, severe neonatal or infantile forms (OPTB1) AD/AR 48 130
TGFB1 Diaphyseal dysplasia Camurati-Engelmann AD 15 23
TNFRSF11A Familial expansile osteolysis, Paget disease of bone, Osteopetrosis, severe neonatal or infantile forms (OPTB1) AD/AR 8 24
TNFRSF11B Paget disease of bone, juvenile AR 8 18
TRAPPC2* Spondyloepiphyseal dysplasia tarda XL 12 55
TRIP11* Achondrogenesis, type IA AR 11 17
TRPV4 Metatropic dysplasia, Spondyloepiphyseal dysplasia Maroteaux type, Parastremmatic dwarfism, Hereditary motor and sensory neuropathy, Spondylometaphyseal dysplasia Kozlowski type, Spinal muscular atrophy, Charcot-Marie-Tooth disease, Brachyolmia (autosomal dominant type), Familial Digital arthropathy with brachydactyly AD 61 78
TTC21B Short-rib thoracic dysplasia, Nephronophthisis, Asphyxiating thoracic dysplasia (ATD; Jeune) AR 23 63
VDR Vitamin D-dependent rickets AD/AR 17 66
WDR19 Retinitis pigmentosa, Nephronophthisis, Short -rib thoracic dysplasia with or without polydactyly, Senior-Loken syndrome, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2, Asphyxiating thoracic dysplasia (ATD; Jeune) AR 33 43
WDR35 Cranioectodermal dysplasia (Levin-Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2, Short rib-polydactyly syndrome type 5 AR 28 31
WISP3 Arthropathy, progressive pseudorheumatoid, of childhood, Spondyloepiphyseal dysplasia tarda with progressive arthropathy AR 16 69
WNT5A Robinow syndrome AD 7 11
XYLT1 Desbuquois dysplasia 2 AR 11 19
#

The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.

*

Some, or all, of the gene is duplicated in the genome. Read more.

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.

Non-coding variants covered by Skeletal Dysplasias Core Panel

To view complete table content, scroll horizontally.

Gene Genomic location HG19 HGVS RefSeq RS-number Comment Reference
ALPL Chr1:21835920 c.-195C>T NM_000478.4
ALPL Chr1:21896764 c.793-30_793-11delGGCATGTGCTGACACAGCCC NM_000478.4
ANKH Chr5:14871567 c.-11C>T NM_054027.4
BMP1 Chr8:22058957 c.*241T>C NM_001199.3 rs786205217
BMPR1B Chr4:95797053 c.-113+2T>G NM_001203.2
CANT1 Chr17:77005745 c.-342+1G>A NM_138793.3
CDKN1C Chr11:2905209 c.*5+20G>T NM_000076.2 rs760540648
CLCN7 Chr16:1506057 c.916+57A>T NM_001287.5
CLCN7 Chr16:1507356 c.739-18G>A NM_001287.5 rs371893553
COL11A1 Chr1:103386637 c.3744+437T>G NM_080629.2
COL11A1 Chr1:103488576 c.1027-24A>G NM_080629.2
COL11A1 Chr1:103491958 c.781-450T>G NM_080629.2 rs587782990
COL1A1 Chr17:48266910 c.2668-11T>G NM_000088.3 rs786205505
COL1A1 Chr17:48267594 c.2451+94G>T NM_000088.3
COL1A1 Chr17:48267611 c.2451+77C>T NM_000088.3 rs72651665
COL1A1 Chr17:48268147 c.2343+31T>A NM_000088.3
COL1A1 Chr17:48272201 c.1354-12G>A NM_000088.3 rs72648337
COL1A1 Chr17:48273368 c.1003-43_1003-32delTGCCATCTCTTC NM_000088.3 rs72645359
COL1A1 Chr17:48273574 c.958-18_958-15delTTCC NM_000088.3 rs72645351
COL1A1 Chr17:48273742 c.904-14G>A NM_000088.3
COL1A1 Chr17:48273743 c.904-15T>A NM_000088.3
COL1A2 Chr7:94025130 c.70+717A>G NM_000089.3 rs72656354
COL1A2 Chr7:94030856 c.226-22_226-11delTTTTTTTTTTTT NM_000089.3
CRTAP Chr3:33160815 c.472-1021C>G NM_006371.4 rs72659360
CTSK Chr1:150778521 c.244-29A>G NM_000396.3
CUL7 Chr6:43010511 c.3897+29G>A NM_001168370.1
DYNC2H1 Chr11:103019205 c.2819-14A>G NM_001080463.1 rs781091611
DYNC2H1 Chr11:103055609 c.6478-16G>A NM_001080463.1 rs376892534
ESCO2 Chr8:27650167 c.1354-18G>A NM_001017420.2 rs80359865
EVC Chr4:5749725 c.940-150T>G NM_153717.2
FGFR2 Chr10:123099960 c.*139411C>T .
FLNA ChrX:153581587 c.6023-27_6023-16delTGACTGACAGCC NM_001110556.1
HSPG2 Chr1:22211006 c.1654+15G>A NM_005529.5
HSPG2 Chr1:22215993 c.574+481C>T NM_005529.5
IFITM5 Chr11:299504 c.-14C>T NM_001025295.2 rs587776916 Explain almost all cases of OI type V PMID 23240094
IFT140 Chr16:1576595 c.2577+25G>A NM_014714.3 rs1423102192
LMX1B Chr9:129377616 c.140-37_140-21delGGCGCTGACGGCCGGGC NM_001174146.1
PEX7 Chr6:137143759 c.-45C>T NM_000288.3 rs267608252
PHEX ChrX:22076478 c.349+11149A>T NM_000444.4
PHEX ChrX:22113485 c.849+1268G>T NM_000444.4
PHEX ChrX:22237137 c.1701-16T>A NM_000444.4
PHEX ChrX:22237393 c.1768+177_1768+180dupGTAA NM_000444.4
PHEX ChrX:22266301 c.*231A>G NM_000444.4
PLS3 ChrX:114856534 c.74-24T>A NM_005032.5
PTH1R Chr3:46939842 c.544-25_544-23delCTG NM_000316.2
PTH1R Chr3:46942604 c.1049+29C>T NM_000316.2
RMRP Chr9:35658026 NR_003051.3
RMRP Chr9:35658026 NR_003051.3
RMRP Chr9:35658026 NR_003051.3
RMRP Chr9:35658026 NR_003051.3 rs781730798
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658027 NR_003051.3 rs727502775
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658028 NR_003051.3
RMRP Chr9:35658028 NR_003051.3
RMRP Chr9:35658029 NR_003051.3
RMRP Chr9:35658029 NR_003051.3
RMRP Chr9:35658032 NR_003051.3
SERPINF1 Chr17:1665408 c.-9+2dupT NM_002615.5 rs398122519
SERPINF1 Chr17:1674512 c.439+34C>T NM_002615.5
SERPINF1 Chr17:1675121 c.440-40_440-38delTCG NM_002615.5 rs775552455
SERPINF1 Chr17:1679209 c.787-617G>A NM_002615.5
SHOX ChrX:585123 c.-645_-644insGTT NM_000451.3 rs199946685
SHOX ChrX:585124 c.-645_-644insGTT NM_000451.3
SHOX ChrX:591198 c.-432-3C>A NM_000451.3
SHOX ChrX:591568 c.-65C>A NM_000451.3
SLC26A2 Chr5:149340544 c.-26+2T>C NM_000112.3 rs386833492
SOX9 Chr17:70117348 c.-185G>A NM_000346.3
TCIRG1 Chr11:67806587 c.-5+1G>C/T NM_006019.3
TCIRG1 Chr11:67806587 c.-5+1G>T NM_006019.3
TCIRG1 Chr11:67806587 c.-5+1G>C NM_006019.3
TCIRG1 Chr11:67816893 c.1887+132T>C NM_006019.3
TCIRG1 Chr11:67816903 c.1887+142T>A NM_006019.3
TCIRG1 Chr11:67816907 c.1887+146G>A NM_006019.3
TCIRG1 Chr11:67816910 c.1887+149C>T NM_006019.3
WDR35 Chr2:20182313 c.143-18T>A NM_001006657.1
WISP3 Chr6:112381431 c.103-763G>T NM_198239.1
WISP3 Chr6:112386227 c.643+27C>G NM_198239.1 rs200472841

Test Strengths

This panel includes also a pathogenic intronic variant that is often missed by exome sequencing: IFITM5 c.-14C>T (rs587776916), which accounts for almost all cases of osteogenesis imperfecta type V (PMID 23240094). Currently, other regions of IFITM5 gene are not yet covered.

The strengths of this test include:

  • CAP accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: ADAMTSL2 NM_014694.4:10-19, SHOX NM_006883.2:6. Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene's target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:

  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:

  • Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments
  • Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section.

The genes on the panels have been carefully selected based on scientific literature, mutation databases and our experience.

The panels are sectioned from our high-quality, clinical grade NGS assay. The panel analysis is a combination of both sequence variants (SNVs and indels) as well as deletions and duplications (copy number variants (CNV)).

Please refer to the table below for performance metrics of the analytical validation of the assay. The validation includes the evaluation of reference samples to determine the capability of the assay to detect various types of variants. The sensitivity values quoted in the analytic validation may not precisely reflect the performance in a production setting and is not a guarantee of the assay’s clinical performance. The provided performance metrics are based on a validation conducted at our laboratory in Finland. The assay has been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva, and dried blood spots (filter cards).

Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Analytical sensitivity to detect single-nucleotide variants and indels were calculated using both versions v3.3.2 and v4.2.1 of high-confidence region benchmark data provided by Genome in a Bottle (GIAB) consortium. Version 4.2.1 is extended to include challenging medically relevant regions and other difficult to map regions. Version 4.2.1 covers 94.1% of reference (GRCh37) and v3.3.2 covers 87.8% of reference. For more information, see GIAB publication https://doi.org/10.1016/j.xgen.2022.100128.

Sensitivity % (TP/(TP+FN) Specificity %
GIAB Version 3.3.2 GIAB Version 4.2.1 GIAB Version 3.3.2 GIAB Version 4.2.1
Single nucleotide variants 99.57 % 97.58 % 100 % 100 %
Insertions, deletions
1-10 bps 95.38 % 95.13 % 100.00 % 100.00 %
11-20 bps 99.09 % 98.15 % 100.00 % 100.00 %
21-50 bps 98.78 % 98.85 % 100.00 % 100.00 %
2-50 bps 97.62 % 97.41 % 100.00 % 100.00 %
Copy number variants (exon level dels/dups, clinical sample performance) Sensitivity Specificity
1 exon level deletion (heterozygous) 100% (14/14) NA
1 exon deletion (homozygous or hemizygous) 100% (5/5) NA
2-4 exon deletion (heterozygous or homozygous) 100% (17/17) NA
5-33 exon deletion (heterozygous) 100% (12/12) NA
1-5 exon duplication (heterozygous or homozygous) 77% (10/13) NA
9-31 exon duplication (heterozygous) 100% (7/7) NA
Simulated CNV detection in reference samples (n=10) Sensitivity
5 exon level deletion/duplication 98 %
Microdeletion/-duplication syndromes (large CNVs, n=22))
Size range (0.1-47 Mb) 100% (22/22)
         
The performance presented above was reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics
Average of median sequencing depths in reference samples 136x
Nucleotides with >20x sequencing coverage (%) 99.77%


Performance of Blueprint Genetics Mitochondrial Sequencing Assay.

ANALYTIC VALIDATION (reference samples; n=4) Sensitivity %      
Single nucleotide variants
Heteroplasmic (45-100%) 100.0% (50/50)
Heteroplasmic (35-45%) 100.0% (87/87)
Heteroplasmic (25-35%) 100.0% (73/73)
Heteroplasmic (15-25%) 100.0% (74/74)
Heteroplasmic (5-15%) 100.0% (79/79)
Heteroplasmic (<5%) 53.3 % (8/15)
CLINICAL VALIDATION (n=20 samples)
Single nucleotide variants (n=18 SNVs) 100.0% (3/3)
Heteroplasmic (10-15%) 100.0% (5/5)
Heteroplasmic (5-10%) 100.0% (5/5)
Heteroplasmic (<5%) 20% (1/5)
Insertions and deletions by sequence analysis (n=3)
Heteroplasmic (45-100%) 1-10bp 100.0% (3/3)
Validation of the mitochondrial genome analysis workflow (based on simulated data of pathogenic mitomap mutations)
Insertions and deletions 1-24 bps by sequence analysis; n=17
Homoplasmic (100%) 1-24bp 100.0% (17/17)
Heteroplasmic (50%) 100.0% (17/17)
Heteroplasmic (25%) 100.0% (17/17)
Heteroplasmic (20%) 100.0% (17/17)
Heteroplasmic (15%) 100.0% (17/17)
Heteroplasmic (10%) 94.1% (16/17)
Heteroplasmic (5%) 94.1% (16/17)
Copy number variants (separate artifical mutations; n=1500)
Homoplasmic (100%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (50%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (30%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (20%) 500 bp, 1kb, 5 kb 99.7%
Heteroplasmic (10%) 500 bp, 1kb, 5 kb 99.0%
Following mtDNA coverage metrics were obtained in clinical samples in the assay validation (n=238)
Mean of medians
Mean sequencing depth MQ0 6334x
Nucleotides with >1000x MQ0 sequencing coverage (%) 100%
rho zero cell line (=no mtDNA), mean sequencing depth in mitochondrial assay validation 12X

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. If the test includes the mitochondrial genome the target region gene list contains the mitochondrial genes. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as  SIFT, PolyPhen,MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with suboptimal coverage (<20X for nuclear genes and <1000X for mtDNA) if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

We provide customers with comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our Ph.D. molecular geneticists, medical professionals, and other highly experienced experts prepare clinical reports by evaluating the identified variants in the context of the phenotypic information provided in the requisition form.

Our goal is to provide clinically meaningful reports that are understandable for all medical professionals regardless of whether they have formal training in genetics. Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015. Sequence and copy number variants classified as pathogenic, likely pathogenic, and variants of uncertain significance (VUS) are confirmed using bidirectional Sanger sequencing or by orthogonal methods such as qPCR/ddPCR when they do not meet our stringent NGS quality metrics for a true positive call.

Our clinical report includes tables for sequence and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, phenotypes, and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene, and phenotype(s), including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts, and detailed information about related phenotypes. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired.

The panel report is divided into primary findings and additional findings sections. Variants reported as primary findings are known disease-causing variants or rare variants that could potentially explain the patient’s phenotype as described to the laboratory at the time of interpretation. The conclusion summarizes all the existing information and provides our rationale for the classification of the variant.

Variants reported as additional findings are variants that are not likely or sufficient to cause the tested patient’s phenotype, based on the current knowledge. Additional findings in panel reports include variants that are, for example, carrierships of single heterozygous variants in genes associated with autosomal recessive disorders, variants of uncertain significance in genes associated with autosomal dominant disorders (if pathogenic or likely pathogenic variants considered sufficient to explain the patient’s phenotype are reported as primary findings), or risk alleles identified in genes included in the panel.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well positioned to reclassify previously reported variants as new information becomes available. If a variant previously reported as a primary or secondary finding by Blueprint Genetics is reclassified so that it becomes diagnostic (VUS to P/LP) or earlier molecular diagnosis is removed (P/LP to VUS, LB, B), our laboratory will issue a follow-up statement to the original ordering healthcare provider at no additional cost.