Comprehensive Muscular Dystrophy / Myopathy Panel

Summary
Is a 161 gene panel that includes assessment of non-coding variants.

In addition, it also includes the maternally inherited mitochondrial genome.
Is ideal for patients with distal myopathy or a clinical suspicion of muscular dystrophy. Includes the smaller Nemaline Myopathy Panel, LGMD and Congenital Muscular Dystrophy Panel, Emery-Dreifuss Muscular Dystrophy Panel and Collagen Type VI-Related Disorders Panel.

Analysis methods
  • PLUS
Availability
4 weeks
Number of genes
161
Test code
NE0701
Panel tier
Tier 4
* The CPT codes provided are based on AMA guidelines and are for informational purposes only. CPT coding is the sole responsibility of the billing party. Please direct any questions regarding coding to the payer being billed.

Summary

The Blueprint Genetics Comprehensive Muscular Dystrophy / Myopathy Panel (test code NE0701):

Read about our accreditations, certifications and CE-marked IVD medical devices here.

ICD Codes

Refer to the most current version of ICD-10-CM manual for a complete list of ICD-10 codes.

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Please see Sample Requirements for accepted saliva kits)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.

Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.

Read more about our sample requirements here.

Muscular dystrophies and myopathies are a complex group of neuromuscular or musculoskeletal disorders that typically result in progressive muscle weakness. The age of onset, affected muscle groups and additional symptoms depend on the type of the disease.

Limb girdle muscular dystrophy (LGMD) is a group of disorders with atrophy and weakness of proximal limb girdle muscles, typically sparing the heart and bulbar muscles. However, cardiac and respiratory impairment may be observed in certain forms of LGMD. In congenital muscular dystrophy (CMD), the onset of muscle weakness typically presents in the newborn period or early infancy. Clinical severity, age of onset, and disease progression are highly variable among the different forms of LGMD/CMD. Phenotypes overlap both within CMD subtypes and among the congenital muscular dystrophies, congenital myopathies, and LGMDs. Emery-Dreifuss muscular dystrophy (EDMD) is a condition that affects mainly skeletal muscle and heart. Usually it presents in early childhood with contractures, which restrict the movement of certain joints – most often elbows, ankles, and neck. Most patients also experience slowly progressive muscle weakness and wasting, beginning with the upper arm and lower leg muscles and progressing to shoulders and hips. Almost all patients with EDMD have cardiac involvement by adulthood. It presents clinically as cardiac conduction defects and/or arrhythmias. The cardiomyopathy phenotype is usually classified as dilated cardiomyopathy (DCM) but also ARVC and hypertrophic cardiomyopathies (HCM) have been described. A small proportion of patients with autosomal dominant EDMD experience cardiac manifestation without any skeletal muscle weakness or wasting.

Dystrophinopathies include a spectrum of muscle diseases ranging from asymptomatic with an increase in serum concentration of creatine phosphokinase to the severe progressive muscle diseases that are classified as Duchenne or Becker muscular dystrophy (DMD or BMD) when skeletal muscle is primarily affected and as DMD-associated DCM when the heart is primarily affected. DMD usually presents in early childhood with delayed milestones, including delays in sitting and standing independently. DMD is rapidly progressive, with affected children being wheelchair dependent by age 13 years and cardiomyopathy occurring soon after that. BMD is characterized by later onset skeletal muscle weakness; some individuals remain ambulatory into their 20s. However, heart failure from DCM is a common cause of death in the mid-40s. DMD-associated DCM is characterized by left ventricular dilation and congestive heart failure. Females heterozygous for a pathogenic variant in DMD are at increased risk for DCM.

The collagen type VI-related disorders are now recognized to be a continuum of overlapping phenotypes with Bethlem myopathy at the mild end and Ullrich congenital muscular dystrophy (UCMD) at the severe end. In between these phenotypes, there are collagen type VI-related limb-girdle muscular dystrophy and myosclerosis myopathy. Bethlem myopathy is characterized by proximal weakness and variable contractures. Elbows, ankles and fingers are most often affected. If the onset is in early childhood, delayed motor milestones, muscle weakness and contractures are evident. Adult onset patients require eventually ambulatory support. UCMD is characterized by congenital muscle weakness, proximal joint contractures, and striking hyperlaxity of distal joints. Affected children rarely gain the ability to walk independently and spinal rigidity and scoliosis develop. Respiratory failure is a common cause of death in the first and second decade of life. Intelligence is normal in both Bethlem myopathy and UCMD.

Nemaline Myopathy is characterized by weakness, hypotonia, and depressed or absent deep tendon reflexes. Histopathologically, nemaline bodies are detected on muscle biopsy. The clinical classification defines six forms of Nemaline Myopathy, which are classified by onset and severity of motor and respiratory involvement. Considerable overlap occurs among the forms.

Genes in the Comprehensive Muscular Dystrophy / Myopathy Panel and their clinical significance

To view complete table content, scroll horizontally.

Gene Associated phenotypes Inheritance ClinVar HGMD
ACAD9 Acyl-CoA dehydrogenase family, deficiency AR 26 61
ACADVL Acyl-CoA dehydrogenase, very long chain, deficiency AR 119 282
ACTA1 Myopathy AD/AR 68 212
ADCK3 Coenzyme Q10 deficiency, Progressive cerebellar ataxia and atrophy, Spinocerebellar ataxia AR 45 43
ANO5 Gnathodiaphyseal dysplasia, LGMD2L and distal MMD3 muscular dystrophies AD/AR 64 121
ATP2A1 Brody myopathy AR 19 18
B3GALNT2# Muscular dystrophy-dystroglycanopathy AR 18 14
B4GAT1 Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 13 AR 3 5
BAG3 Dilated cardiomyopathy (DCM), Myopathy, myofibrillar AD 39 62
BICD2 Childhood-onset proximal spinal muscular atrophy with contractures AD 12 28
BIN1 Myopathy, centronuclear AD/AR 9 15
CAPN3 Muscular dystrophy, limb-girdle, Eosinophilic myositis AD/AR 184 437
CASQ1 Myopathy, vacuolar, with CASQ1 aggregates AD 2 5
CAV3 Creatine phosphokinase, elevated serum, Hypertrophic cardiomyopathy (HCM), Long QT syndrome, Muscular dystrophy, limb-girdle, type IC, Myopathy, distal, Tateyama type, Rippling muscle disease 2 AD/AR 23 50
CFL2 Nemaline myopathy AR 2 9
CHKB Muscular dystrophy, congenital, megaconial AR 11 27
CNTN1 Myopathy, congenital, Compton-North AR 5 2
COL12A1 Bethlem myopathy, Ullrich congenital muscular dystrophy AD/AR 14 13
COL4A1 Schizencephaly, Anterior segment dysgenesis with cerebral involvement, Retinal artery tortuosity, Porencephaly, Angiopathy, hereditary, with nephropathy, aneurysms, and muscle cramps, Brain small vessel disease AD 58 107
COL4A2 Hemorrhage, intracerebral AD 14 12
COL6A1 Bethlem myopathy, Ullrich congenital muscular dystrophy AD/AR 81 132
COL6A2 Epilepsy, progressive myoclonic, Bethlem myopathy, Myosclerosis, congenital, Ullrich congenital muscular dystrophy AD/AR 101 182
COL6A3 Bethlem myopathy, Dystonia, Ullrich congenital muscular dystrophy AD/AR 68 138
COQ2 Coenzyme Q10 deficiency AR 16 31
CRYAB Cataract, myofibrillar myopathy and cardiomyopathy, Congenital cataract and cardiomyopathy, Dilated cardiomyopathy (DCM), Myopathy, myofibrillar, Cataract 16, multiple types, Myopathy, myofibrillar, fatal infantile hypertonic, alpha-B crystallin-related AD 14 28
DAG1 Muscular dystrophy-dystroglycanopathy AR 12 10
DES Dilated cardiomyopathy (DCM), Myopathy, myofibrillar, Scapuloperoneal syndrome, neurogenic, Kaeser type AD/AR 64 124
DGUOK Mitochondrial DNA depletion syndrome, Portal hypertension, noncirrhotic, Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 4 AR 23 62
DMD Becker muscular dystrophy, Duchenne muscular dystrophy, Dilated cardiomyopathy (DCM) XL 832 3915
DNAJB6 Muscular dystrophy, limb-girdle AD 11 17
DPM3 Congenital disorder of glycosylation, Dilated cardiomyopathy (DCM), Limb-girdle muscular dystrophy AR 3 2
DYSF Miyoshi muscular dystrophy, Muscular dystrophy, limb-girdle, Myopathy, distal, with anterior tibial onset AR 244 529
EMD Emery-Dreifuss muscular dystrophy XL 48 113
FDX1L Myopathy AR 1 2
FHL1* Myopathy with postural muscle atrophy, Emery-Dreifuss muscular dystrophy, Reducing bod myopathy XL 26 62
FKRP Muscular dystrophy-dystroglycanopathy AR 66 140
FKTN Muscular dystrophy-dystroglycanopathy, Dilated cardiomyopathy (DCM), Muscular dystrophy-dystroglycanopathy (limb-girdle) AD/AR 45 58
FLAD1 Lipid storage myopathy due to FLAD1 deficiency (LSMFLAD) AR 9 10
FLNC* Myopathy AD 54 109
GAA Glycogen storage disease AR 193 573
GBE1 Glycogen storage disease AR 36 70
GMPPB Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), Limb-girdle muscular dystrophy-dystroglycanopathy AR 19 41
GOLGA2 Microcephaly, seizures, and developmental delay AR 2
GYG1 Glycogen storage disease, Polyglucosan body myopathy 2 AR 9 16
HNRNPDL Muscular dystrophy, limb-girdle, type 1G AD 3 2
INPP5K Muscular dystrophy, congenital, with cataracts and intellectual disability (MDCCAID) AR 8 10
ISCU Myopathy with lactic acidosis AR 3 3
ISPD Muscular dystrophy-dystroglycanopathy AR 38 53
ITGA7 Muscular dystrophy, congenital, due to integrin alpha-7 deficiency AR 16 8
KBTBD13 Nemaline myopathy AD 4 10
KLHL40 Nemaline myopathy AR 11 26
KLHL41 Nemaline myopathy AR 8 8
LAMA2 Muscular dystrophy, congenital merosin-deficient AR 199 301
LAMP2 Danon disease XL 62 101
LARGE Muscular dystrophy-dystroglycanopathy AR 19 27
LDB3 Dilated cardiomyopathy (DCM), Myopathy, myofibrillar AD 9 14
LIMS2 Muscular dystrophy, limb-girdle AR 2 3
LMNA Heart-hand syndrome, Slovenian, Limb-girdle muscular dystrophy, Muscular dystrophy, congenital, LMNA-related, Lipodystrophy (Dunnigan), Emery-Dreiffus muscular dystrophy, Malouf syndrome, Dilated cardiomyopathy (DCM), Mandibuloacral dysplasia type A, Progeria Hutchinson-Gilford type AD/AR 250 564
LMOD3 Severe congenital nemaline myopathy, Typical nemaline myopathy AR 8 15
MAP3K20 Centronuclear myopathy AR 5 7
MEGF10 Myopathy, early-onset, areflexia, respiratory distress, and dysphagia AR 20 19
MICU1 Myopathy with extrapyramidal signs AR 10 8
MME Spinocerebellar ataxia 43, Charcot-Marie-Tooth disease, axonal, type 2T AD/AR 14 21
MSTO1* Myopathy, mitochondrial, and ataxia AR 7 8
MT-ATP6 Neuropathy, ataxia, and retinitis pigmentosa, Leber hereditary optic neuropathy, Ataxia and polyneuropathy, adult-onset, Cardiomyopathy, infantile hypertrophic, Leigh syndrome, Striatonigral degeneration, infantile, mitochondrial Mitochondrial 19
MT-ATP8 Cardiomyopathy, apical hypertrophic, and neuropathy, Cardiomyopathy, infantile hypertrophic Mitochondrial 4
MT-CO1 Myoglobinuria, recurrent, Leber hereditary optic neuropathy, Sideroblastic anemia, Cytochrome C oxidase deficiency Mitochondrial 17
MT-CO2 Cytochrome c oxidase deficiency Mitochondrial 8
MT-CO3 Cytochrome c oxidase deficiency, Leber hereditary optic neuropathy Mitochondrial 9
MT-CYB Mitochondrial 69
MT-ND1 Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes, Leber hereditary optic neuropathy, Leber optic atrophy and dystonia Mitochondrial 21
MT-ND2 Leber hereditary optic neuropathy, Mitochondrial complex I deficiency Mitochondrial 6
MT-ND3 Leber optic atrophy and dystonia, Mitochondrial complex I deficiency Mitochondrial 7
MT-ND4 Leber hereditary optic neuropathy, Leber optic atrophy and dystonia, Mitochondrial complex I deficiency Mitochondrial 11
MT-ND4L Leber hereditary optic neuropathy Mitochondrial 2
MT-ND5 Myoclonic epilepsy with ragged red fibers, Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes, Leber hereditary optic neuropathy, Mitochondrial complex I deficiency Mitochondrial 19
MT-ND6 Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes, Oncocytoma, Leber hereditary optic neuropathy, Leber optic atrophy and dystonia, Mitochondrial complex I deficiency Mitochondrial 16
MT-RNR1 Deafness, mitochondrial Mitochondrial 3
MT-RNR2 Chloramphenicol toxicity/resistance Mitochondrial 2
MT-TA Mitochondrial 4
MT-TC Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes Mitochondrial 3
MT-TD Mitochondrial 1
MT-TE Diabetes-deafness syndrome, Mitochondrial myopathy, infantile, transient, Mitochondrial myopathy with diabetes Mitochondrial 5
MT-TF Myoclonic epilepsy with ragged red fibers, Nephropathy, tubulointerstitial, Encephalopathy, mitochondrial, Epilepsy, mitochondrial, Myopathy, mitochondrial, Mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes Mitochondrial 7
MT-TG Mitochondrial 3
MT-TH Mitochondrial 4
MT-TI Mitochondrial 7
MT-TK Mitochondrial 5
MT-TL1 Cytochrome c oxidase deficiency, Myoclonic epilepsy with ragged red fibers, Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes, Diabetes-deafness syndrome, Cyclic vomiting syndrome, SIDS, susceptibility to Mitochondrial 14
MT-TL2 Mitochondrial multisystemic disorder, Progressive external ophthalmoplegia Mitochondrial 5
MT-TM Leigh syndrome, Mitochondrial multisystemic disorder Mitochondrial 1
MT-TN Progressive external ophthalmoplegia, Mitochondrial multisystemic disorder Mitochondrial 3
MT-TP Mitochondrial 2
MT-TQ Mitochondrial multisystemic disorder Mitochondrial 2
MT-TR Encephalopathy, mitochondrial Mitochondrial 2
MT-TS1 Myoclonic epilepsy with ragged red fibers, Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes Mitochondrial 10
MT-TS2 Mitochondrial multisystemic disorder Mitochondrial 2
MT-TT Mitochondrial 5
MT-TV Hypertrophic cardiomyopathy (HCM), Leigh syndrome, Mitochondrial multisystemic disorder Mitochondrial 3
MT-TW Leigh syndrome, Myopathy, mitochondrial Mitochondrial 8
MT-TY Mitochondrial multisystemic disorder Mitochondrial 4
MTM1 Myopathy, centronuclear XL 158 301
MYH7 Hypertrophic cardiomyopathy (HCM), Myopathy, myosin storage, Myopathy, distal, Dilated cardiomyopathy (DCM) AD 305 986
MYO18B Klippel-Feil syndrome 4, autosomal recessive, with myopathy and facial dysmorphism AR 2 4
MYOT Myopathy, myofibrillar, Muscular dystrophy, limb-girdle, 1A, Myopathy, spheroid body AD 6 16
NEB#* Nemaline myopathy AR 305 309
PABPN1 Oculopharyngeal muscular dystrophy AD/AR 6 23
PGK1 Phosphoglycerate kinase 1 deficiency XL 16 26
PHKA1 Glycogen storage disease XL 9 8
PHKB Glycogen storage disease AR 9 26
PLEC Muscular dystrophy, limb-girdle, Epidermolysis bullosa AD/AR 36 103
PNPLA2 Neutral lipid storage disease with myopathy AR 13 35
POGLUT1 Dowling-Degos disease 4, Muscular dystrophy, limb-girdle, type 2Z AD 6 13
POLG POLG-related ataxia neuropathy spectrum disorders, Sensory ataxia, dysarthria, and ophthalmoparesis, Alpers syndrome, Progressive external ophthalmoplegia with mitochondrial DNA deletions, Mitochondrial DNA depletion syndrome AD/AR 89 290
POLG2 Progressive external ophthalmoplegia with mitochondrial DNA deletions AD 5 14
POMGNT1 Muscular dystrophy-dystroglycanopathy AR 96 88
POMGNT2 Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 8 AR 6 9
POMK Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies, type A, 12, Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies, type C, 12, Muscle-eye brain disease, Walker-Warburg syndrome AR 6 8
POMT1 Muscular dystrophy-dystroglycanopathy AR 47 96
POMT2 Muscular dystrophy-dystroglycanopathy AR 45 73
PYGM Glycogen storage disease AR 77 168
PYROXD1* Myopathy, myofibrillar 8 AR 5 6
RBCK1 Polyglucosan body myopathy AR 11 14
RRM2B Progressive external ophthalmoplegia with mitochondrial DNA deletions, Mitochondrial DNA depletion syndrome AD/AR 41 41
RYR1 Central core disease, Malignant hyperthermia, Minicore myopathy with external ophthalmoplegia, Centronuclear myopathy, Minicore myopathy, Multicore myopathy AD/AR 241 666
SCN4A Hyperkalemic periodic paralysis, Myotonia, potassium-aggravated, Paramyotonia congenita, Myasthenic syndrome, congenital, Normokalemic potassium-sensitive periodic paralysis AD/AR 57 126
SELENON# Muscular dystrophy, rigid spine, Myopathy, congenital, with fiber- disproportion AR 38 63
SEPT9 Amyotrophy, hereditary neuralgic AD 4 11
SGCA Muscular dystrophy, limb-girdle AR 60 100
SGCB Muscular dystrophy, limb-girdle AR 37 64
SGCD Muscular dystrophy, limb-girdle, Dilated cardiomyopathy (DCM) AR 21 27
SGCG Muscular dystrophy, limb-girdle AR 33 63
SIL1 Marinesco-Sjogren syndrome AR 14 49
SLC22A5 Carnitine deficiency, systemic primary AR 98 151
SLC25A20 Carnitine-acylcarnitine translocase deficiency AR 15 42
SMCHD1 Facioscapulohumeral muscular dystrophy, Facioscapulohumeral muscular dystrophy, type 2 AD 51 79
SMN1#* Spinal muscular atrophy AR 29 111
SMN2#* Spinal muscular atrophy AD 1 9
SPEG Centronuclear myopathy 5 AR 5 11
SPTBN4 Myopathy, congenital, with neuropathy and deafness AR 6 7
STAC3 Native American myopathy 3 4
SUCLA2 Mitochondrial DNA depletion syndrome AR 9 29
SUCLG1 Mitochondrial DNA depletion syndrome AR 12 28
SYNE1 Spinocerebellar ataxia, autosomal recessive 8 AD/AR 83 136
TANGO2 Metabolic encephalomyopathic crises, recurrent, with rhabdomyolysis, cardiac arrhythmias, and neurodegeneration (MECRCN) AR 13 9
TCAP Muscular dystrophy, limb-girdle, Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy (DCM) AD/AR 12 28
TIA1 Welander distal myopathy AD 1 13
TMEM126B Mitochondrial complex I deficiency AR 4 4
TMEM43 Arrhythmogenic right ventricular dysplasia, Emery-Dreifuss muscular dystrophy AD 4 24
TNNT1 Nemaline myopathy AR 6 8
TNPO3 Muscular dystrophy, limb-girdle AD 3 5
TOR1AIP1 Muscular dystrophy with progressive weakness, distal contractures and rigid spine AD/AR 3 5
TPM2 CAP myopathy, Nemaline myopathy, Arthrogryposis, distal AD 18 38
TPM3* CAP myopathy, Nemaline myopathy, Myopathy, congenital, with fiber- disproportion AD 21 27
TRAPPC11 Limb-girdle muscular dystrophy AR 13 17
TRIM32 Bardet-Biedl syndrome, Muscular dystrophy, limb-girdle AR 13 16
TSFM# Combined oxidative phosphorylation deficiency AR 6 6
TTN* Dilated cardiomyopathy (DCM), Tibial muscular dystrophy, Limb-girdle muscular dystrophy, Hereditary myopathy with early respiratory failure, Myopathy, early-onset, with fatal cardiomyopathy (Salih myopathy), Muscular dystrophy, limb-girdle, type 2J AD 818 327
TYMP Mitochondrial DNA depletion syndrome AR 84 94
VMA21 Myopathy, X-linked, with excessive autophagy XL 9 11
VPS13A Choreoacanthocytosis AR 19 115
#

The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.

*

Some, or all, of the gene is duplicated in the genome. Read more.

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.

Non-coding variants covered by Comprehensive Muscular Dystrophy / Myopathy Panel

To view complete table content, scroll horizontally.

Gene Genomic location HG19 HGVS RefSeq RS-number
ACADVL Chr17:7123160 c.-144_-132delCCCAGCATGCCCCinsT NM_000018.3
ACADVL Chr17:7125469 c.822-27C>T NM_001270447.1 rs374911841
ACADVL Chr17:7125485 c.822-11T>G NM_001270447.1
ACADVL Chr17:7126199 c.1146+15C>T NM_001270447.1 rs202237278
ACADVL Chr17:7126948 c.1252-15A>G NM_001270447.1 rs765390290
ACADVL Chr17:7127894 c.1747+23C>T NM_001270447.1 rs147546456
ADCK3 Chr1:227174508 c.*72dupG NM_020247.4
CAPN3 Chr15:42678352 c.380-13T>A NM_000070.2
CAPN3 Chr15:42695919 c.1746-20C>T NM_000070.2
CAPN3 Chr15:42697047 c.-188G>C NM_173089.1
CAPN3 Chr15:42702715 c.2184+21G>A NM_000070.2 rs763572829
CAPN3 Chr15:42702770 c.2185-16A>G NM_000070.2
COL4A1 Chr13:110802675 c.*35C>A NM_001845.4
COL4A1 Chr13:110802678 c.*32G>A/T NM_001845.4
COL4A1 Chr13:110802679 c.*31G>T NM_001845.4
COL6A1 Chr21:47409500 c.859-22A>G NM_001848.2 rs398123642
COL6A1 Chr21:47409627 c.904-39A>G NM_001848.2
COL6A1 Chr21:47409881 c.930+189C>T NM_001848.2
COL6A1 Chr21:47413935 c.1336-146C>T NM_001848.2
COL6A2 Chr21:47538492 c.1117-35_1118dupAAAAGACGTGAGGCTGATTCTGCAAACCCTTCCAGGG NM_001849.3
COL6A2 Chr21:47541407 c.1459-63G>A NM_001849.3
COL6A3 Chr2:238268046 c.6283-15C>A NM_004369.3
DGUOK Chr2:74177650 c.444-62C>A NM_080916.2
DGUOK Chr2:74177701 c.444-11C>G NM_080916.2 rs536746349
DMD ChrX:31165653 c.10554-18C>G NM_004006.2
DMD ChrX:31200680 c.9974+175T>A NM_004006.2
DMD ChrX:31224814 c.9564-30A>T NM_004006.2
DMD ChrX:31225211 c.9564-427T>G NM_004006.2
DMD ChrX:31226400 c.9563+1215A>G NM_004006.2
DMD ChrX:31229031 c.9362-1215A>G NM_004006.2
DMD ChrX:31241047 c.9361+117A>G NM_004006.2
DMD ChrX:31279293 c.9225-160A>G NM_004006.2
DMD ChrX:31279418 c.9225-285A>G NM_004006.2
DMD ChrX:31279420 c.9225-287C>A NM_004006.2
DMD ChrX:31279780 c.9225-647A>G NM_004006.2 rs398124091
DMD ChrX:31279781 c.9225-648A>G NM_004006.2 rs398124084
DMD ChrX:31332523 c.9224+9192C>A NM_004006.2
DMD ChrX:31382270 c.9085-15519G>T NM_004006.2
DMD ChrX:31613687 c.8217+32103G>T NM_004006.2
DMD ChrX:31627738 c.8217+18052A>G NM_004006.2
DMD ChrX:31697714 c.7661-11T>C NM_004006.2
DMD ChrX:31983146 c.6614+3310G>T NM_004006.2 rs797045526
DMD ChrX:32305833 c.6118-15A>G NM_004006.2
DMD ChrX:32360414 c.5740-15G>T NM_004006.2
DMD ChrX:32366860 c.5326-215T>G NM_004006.2
DMD ChrX:32379144 c.5325+1743_5325+1760delTATTAAAAAATGGGTAGA NM_004006.2
DMD ChrX:32398808 c.4675-11A>G NM_004006.2
DMD ChrX:32460274 c.3787-843C>A NM_004006.2
DMD ChrX:32470726 c.3603+2053G>C NM_004006.2
DMD ChrX:32479316 c.3432+2240A>G NM_004006.2
DMD ChrX:32479520 c.3432+2036A>G NM_004006.2
DMD ChrX:32669100 c.961-5831C>T NM_004006.2 rs398124099
DMD ChrX:32669194 c.961-5925A>C NM_004006.2
DMD ChrX:32716130 c.832-15A>G NM_004006.2 rs72470513
DMD ChrX:32827744 c.531-16T>A NM_004006.2
DMD ChrX:32827744 c.531-16T>G NM_004006.2
DMD ChrX:32827744 c.531-16T>A/G NM_004006.2
DMD ChrX:32841967 c.265-463A>G NM_004006.2
DMD ChrX:33032666 c.93+5590T>A NM_004006.2
DMD ChrX:33192452 c.31+36947G>A NM_004006.2
DMD ChrX:33229483 c.-54T>A NM_004006.2
DYSF Chr2:71817308 c.3443-33A>G NM_003494.3 rs786205083
DYSF Chr2:71840553 c.4410+13T>G NM_003494.3
DYSF Chr2:71889030 c.4886+1249G>T NM_003494.3
DYSF Chr2:71900503 c.5668-824C>T NM_003494.3
DYSF Chr2:71913729 c.*107T>A NM_003494.3 rs11903223
EMD ChrX:153608559 c.266-27_266-10delTCTGCTACCGCTGCCCCC NM_000117.2
FKRP Chr19:47249328 c.-272G>A NM_024301.4
FKTN Chr9:108368857 c.648-1243G>T NM_006731.2
GAA Chr17:78078341 c.-32-13T>A NM_000152.3
GAA Chr17:78078341 c.-32-13T>G NM_000152.3 rs386834236
GAA Chr17:78078351 c.-32-3C>A/G NM_000152.3
GAA Chr17:78078352 c.-32-2A>G NM_000152.3
GAA Chr17:78078353 c.-32-1G>C NM_000152.3
GAA Chr17:78078369 c.-17C>T NM_000152.3
GAA Chr17:78082266 c.1076-22T>G NM_000152.3 rs762260678
GAA Chr17:78090422 c.2190-345A>G NM_000152.3
GAA Chr17:78092432 c.2647-20T>G NM_000152.3
GMPPB Chr3:49761246 c.-87C>T NM_013334.3 rs780961444
GYG1 Chr3:148717967 c.481+3276C>G NM_004130.3
ISCU Chr12:108961426 c.418+382G>C NM_213595.2 rs767000507
LAMA2 Chr6:129633984 c.3175-22G>A NM_000426.3 rs777129293
LAMA2 Chr6:129636608 c.3556-13T>A NM_000426.3 rs775278003
LAMA2 Chr6:129714172 c.5235-18G>A NM_000426.3 rs188365084
LAMA2 Chr6:129835506 c.8989-12C>G NM_000426.3 rs144860334
LMNA Chr1:156100609 c.513+45T>G NM_170707.3
LMNA Chr1:156105681 c.937-11C>G NM_170707.3 rs267607645
LMNA Chr1:156107037 c.1608+14G>A NM_170707.3
LMNA Chr1:156107433 c.1609-12T>G NM_170707.3 rs267607582
MTM1 ChrX:149767035 c.137-19_137-16delACTT NM_000252.2
MTM1 ChrX:149767045 c.137-11T>A NM_000252.2
MTM1 ChrX:149783032 c.232-26_232-23delGACT NM_000252.2
MTM1 ChrX:149808833 c.529-909A>G NM_000252.2
MTM1 ChrX:149818176 c.868-13T>A NM_000252.2
NEB Chr2:152355017 c.24220-151C>A NM_001271208.1
PGK1 ChrX:77381262 c.1214-25T>G NM_000291.3
POMT1 Chr9:134379574 c.-30-2A>G NM_007171.3
POMT2 Chr14:77751989 c.1333-14G>A NM_013382.5
PYGM Chr11:64523631 c.661-601G>A NM_005609.2
PYGM Chr11:64525847 c.425-26A>G NM_005609.2 rs764313717
RYR1 Chr19:38997317 c.8692+131G>A NM_000540.2
SELENON Chr1:26143316 c.*1107T>C NM_020451.2
SEPT9 Chr17:75316275 c.-134G>C NM_006640.4 rs80338760
SGCA Chr17:48246419 c.585-31_585-23delTCTGCTGAC NM_000023.2
SGCA Chr17:48246421 c.585-31_585-24delTCTGCTGA NM_000023.2
SGCA Chr17:48247492 c.748-12_748-11delCTinsAA NM_000023.2
SGCG Chr13:23755086 c.-127_-121delACAGTTG NM_000231.2 rs1422849467
SGCG Chr13:23755215 c.-1+1G>T NM_000231.2
SIL1 Chr5:138283180 c.1030-18G>A NM_022464.4 rs769052639
SLC22A5 Chr5:131714054 c.394-16T>A NM_003060.3 rs775097754
SLC22A5 Chr5:131722665 c.825-52G>A NM_003060.3
SMCHD1 Chr18:2705677 c.1843-15A>G NM_015295.2
SMCHD1 Chr18:2743740 c.3634-19A>G NM_015295.2
SYNE1 Chr6:152640163 c.16237-13C>G NM_182961.3
SYNE1 Chr6:152643033 c.15918-12A>G NM_182961.3 rs606231134
VMA21 ChrX:150572076 c.54-27A>C NM_001017980.3 rs878854352
VMA21 ChrX:150572076 c.54-27A>T NM_001017980.3
VMA21 ChrX:150572076 c.54-27A>C/T NM_001017980.3
VMA21 ChrX:150572082 c.54-16_54-8delGTTTACTTT NM_001017980.3 rs878854357

Test Strengths

The strengths of this test include:

  • CAP accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: B3GALNT2 NM_001277155.3:2, SELENON NM_020451.3:3, TSFM NM_001172696.2:5. Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene's target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:

  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:

  • Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments
  • Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section.

The genes on the panels have been carefully selected based on scientific literature, mutation databases and our experience.

The panels are sectioned from our high-quality, clinical grade NGS assay. The panel analysis is a combination of both sequence variants (SNVs and indels) as well as deletions and duplications (copy number variants (CNV)).

Please refer to the table below for performance metrics of the analytical validation of the assay. The validation includes the evaluation of reference samples to determine the capability of the assay to detect various types of variants. The sensitivity values quoted in the analytic validation may not precisely reflect the performance in a production setting and is not a guarantee of the assay’s clinical performance. The provided performance metrics are based on a validation conducted at our laboratory in Finland. The assay has been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva, and dried blood spots (filter cards).

Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Analytical sensitivity to detect single-nucleotide variants and indels were calculated using both versions v3.3.2 and v4.2.1 of high-confidence region benchmark data provided by Genome in a Bottle (GIAB) consortium. Version 4.2.1 is extended to include challenging medically relevant regions and other difficult to map regions. Version 4.2.1 covers 94.1% of reference (GRCh37) and v3.3.2 covers 87.8% of reference. For more information, see GIAB publication https://doi.org/10.1016/j.xgen.2022.100128.

Sensitivity % (TP/(TP+FN) Specificity %
GIAB Version 3.3.2 GIAB Version 4.2.1 GIAB Version 3.3.2 GIAB Version 4.2.1
Single nucleotide variants 99.57 % 97.58 % 100 % 100 %
Insertions, deletions
1-10 bps 95.38 % 95.13 % 100.00 % 100.00 %
11-20 bps 99.09 % 98.15 % 100.00 % 100.00 %
21-50 bps 98.78 % 98.85 % 100.00 % 100.00 %
2-50 bps 97.62 % 97.41 % 100.00 % 100.00 %
Copy number variants (exon level dels/dups, clinical sample performance) Sensitivity Specificity
1 exon level deletion (heterozygous) 100% (14/14) NA
1 exon deletion (homozygous or hemizygous) 100% (5/5) NA
2-4 exon deletion (heterozygous or homozygous) 100% (17/17) NA
5-33 exon deletion (heterozygous) 100% (12/12) NA
1-5 exon duplication (heterozygous or homozygous) 77% (10/13) NA
9-31 exon duplication (heterozygous) 100% (7/7) NA
Simulated CNV detection in reference samples (n=10) Sensitivity
5 exon level deletion/duplication 98 %
Microdeletion/-duplication syndromes (large CNVs, n=22))
Size range (0.1-47 Mb) 100% (22/22)
         
The performance presented above was reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics
Average of median sequencing depths in reference samples 136x
Nucleotides with >20x sequencing coverage (%) 99.77%


Performance of Blueprint Genetics Mitochondrial Sequencing Assay.

ANALYTIC VALIDATION (reference samples; n=4) Sensitivity %      
Single nucleotide variants
Heteroplasmic (45-100%) 100.0% (50/50)
Heteroplasmic (35-45%) 100.0% (87/87)
Heteroplasmic (25-35%) 100.0% (73/73)
Heteroplasmic (15-25%) 100.0% (74/74)
Heteroplasmic (5-15%) 100.0% (79/79)
Heteroplasmic (<5%) 53.3 % (8/15)
CLINICAL VALIDATION (n=20 samples)
Single nucleotide variants (n=18 SNVs) 100.0% (3/3)
Heteroplasmic (10-15%) 100.0% (5/5)
Heteroplasmic (5-10%) 100.0% (5/5)
Heteroplasmic (<5%) 20% (1/5)
Insertions and deletions by sequence analysis (n=3)
Heteroplasmic (45-100%) 1-10bp 100.0% (3/3)
Validation of the mitochondrial genome analysis workflow (based on simulated data of pathogenic mitomap mutations)
Insertions and deletions 1-24 bps by sequence analysis; n=17
Homoplasmic (100%) 1-24bp 100.0% (17/17)
Heteroplasmic (50%) 100.0% (17/17)
Heteroplasmic (25%) 100.0% (17/17)
Heteroplasmic (20%) 100.0% (17/17)
Heteroplasmic (15%) 100.0% (17/17)
Heteroplasmic (10%) 94.1% (16/17)
Heteroplasmic (5%) 94.1% (16/17)
Copy number variants (separate artifical mutations; n=1500)
Homoplasmic (100%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (50%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (30%) 500 bp, 1kb, 5 kb 100.0%
Heteroplasmic (20%) 500 bp, 1kb, 5 kb 99.7%
Heteroplasmic (10%) 500 bp, 1kb, 5 kb 99.0%
Following mtDNA coverage metrics were obtained in clinical samples in the assay validation (n=238)
Mean of medians
Mean sequencing depth MQ0 6334x
Nucleotides with >1000x MQ0 sequencing coverage (%) 100%
rho zero cell line (=no mtDNA), mean sequencing depth in mitochondrial assay validation 12X

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. If the test includes the mitochondrial genome the target region gene list contains the mitochondrial genes. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as  SIFT, PolyPhen,MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with suboptimal coverage (<20X for nuclear genes and <1000X for mtDNA) if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

We provide customers with comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our Ph.D. molecular geneticists, medical professionals, and other highly experienced experts prepare clinical reports by evaluating the identified variants in the context of the phenotypic information provided in the requisition form.

Our goal is to provide clinically meaningful reports that are understandable for all medical professionals regardless of whether they have formal training in genetics. Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015. Sequence and copy number variants classified as pathogenic, likely pathogenic, and variants of uncertain significance (VUS) are confirmed using bidirectional Sanger sequencing or by orthogonal methods such as qPCR/ddPCR when they do not meet our stringent NGS quality metrics for a true positive call.

Our clinical report includes tables for sequence and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, phenotypes, and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene, and phenotype(s), including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts, and detailed information about related phenotypes. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired.

The panel report is divided into primary findings and additional findings sections. Variants reported as primary findings are known disease-causing variants or rare variants that could potentially explain the patient’s phenotype as described to the laboratory at the time of interpretation. The conclusion summarizes all the existing information and provides our rationale for the classification of the variant.

Variants reported as additional findings are variants that are not likely or sufficient to cause the tested patient’s phenotype, based on the current knowledge. Additional findings in panel reports include variants that are, for example, carrierships of single heterozygous variants in genes associated with autosomal recessive disorders, variants of uncertain significance in genes associated with autosomal dominant disorders (if pathogenic or likely pathogenic variants considered sufficient to explain the patient’s phenotype are reported as primary findings), or risk alleles identified in genes included in the panel.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well positioned to reclassify previously reported variants as new information becomes available. If a variant previously reported as a primary or secondary finding by Blueprint Genetics is reclassified so that it becomes diagnostic (VUS to P/LP) or earlier molecular diagnosis is removed (P/LP to VUS, LB, B), our laboratory will issue a follow-up statement to the original ordering healthcare provider at no additional cost.